EMAIL THIS PAGE TO A FRIEND

TMC7

transmembrane channel-like 7

UniProtKB ID: Q7Z402, Q5H9Q8, Q7Z5M4, Q86WX0, Q9H766
Gene ID:
Mouse(209760) transmembrane channel-like gene family 7
Rat(499254) transmembrane channel-like 7
chicken(416610) transmembrane channel-like 7
dog(489990) transmembrane channel-like 7
domestic cat(101094227) transmembrane channel-like 7
domestic guinea pig(100732433) transmembrane channel-like 7
naked mole-rat(101701168) transmembrane channel-like 7
cow(785640) transmembrane channel-like 7
sheep(101116696) transmembrane channel-like 7
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029465 Anti-TMC7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024847 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023541 MISSION® esiRNA esiRNA human TMC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024847 Rosetta Predictions human pricing
XM_001078829 Rosetta Predictions rat pricing
XM_574547 Rosetta Predictions rat pricing
NM_172476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224636 predicted 1271
2 SASI_Hs02_00357423 predicted 1526
3 SASI_Hs01_00224637 predicted 356
4 SASI_Hs01_00224638 predicted 414
5 SASI_Hs01_00224639 predicted 850
6 SASI_Hs02_00357424 predicted 619
7 SASI_Hs01_00224640 predicted 1485
8 SASI_Hs02_00357425 predicted 339
9 SASI_Hs01_00224642 predicted 2226
10 SASI_Hs01_00224643 predicted 1455
11 SASI_Hs01_00224641 predicted 2187
12 SASI_Hs01_00224644 predicted 704
13 SASI_Hs01_00224645 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362150 predicted 691
2 SASI_Rn02_00362151 predicted 501
3 SASI_Rn02_00362152 predicted 682
4 SASI_Rn02_00362153 predicted 1362
5 SASI_Rn02_00362154 predicted 1129
6 SASI_Rn02_00362155 predicted 662
7 SASI_Rn02_00362156 predicted 643
8 SASI_Rn02_00362157 predicted 590
9 SASI_Rn02_00362158 predicted 1807
10 SASI_Rn02_00362159 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402152 predicted 695
2 SASI_Rn02_00402153 predicted 502
3 SASI_Rn02_00402154 predicted 679
4 SASI_Rn02_00402155 predicted 1362
5 SASI_Rn02_00402156 predicted 1126
6 SASI_Rn02_00402157 predicted 666
7 SASI_Rn02_00402158 predicted 636
8 SASI_Rn02_00402159 predicted 595
9 SASI_Rn02_00402160 predicted 1801
10 SASI_Rn02_00402161 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096317 predicted 917
2 SASI_Mm01_00096318 predicted 446
3 SASI_Mm01_00096319 predicted 582
4 SASI_Mm01_00096320 predicted 762
5 SASI_Mm01_00096321 predicted 315
6 SASI_Mm01_00096322 predicted 532
7 SASI_Mm02_00344029 predicted 320
8 SASI_Mm01_00096323 predicted 567
9 SASI_Mm01_00096324 predicted 1718
10 SASI_Mm01_00096325 predicted 1742
11 SASI_Mm01_00096326 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172476
TMC7 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-527s21c1
Sequence:CCGGGTGCTGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-312s21c1
Sequence:CCGGAGCGGAGACTAAGGGACATTCCTCGAGGAATGTCCCTTAGTCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-1070s21c1
Sequence:CCGGGAGGAGACCATCCGCATTTACCTCGAGGTAAATGCGGATGGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-582s21c1
Sequence:CCGGTACTCACCAAGTACAAGATTACTCGAGTAATCTTGTACTTGGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1909s1c1
Sequence:CCGGCGGCCCATTTACCAACTTCAACTCGAGTTGAAGTTGGTAAATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-286s1c1
Sequence:CCGGCCGCAAGTATGCACTGAACATCTCGAGATGTTCAGTGCATACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1507s1c1
Sequence:CCGGGCTGATGATCTTCGACTTCATCTCGAGATGAAGTCGAAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172476.2-2211s1c1
Sequence:CCGGGCCCGAAACTTCTCAACACATCTCGAGATGTGTTGAGAAGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-815s1c1
Sequence:CCGGGCTTACTTGATAAGCACGATTCTCGAGAATCGTGCTTATCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172476
TMC7 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-527s21c1
Sequence:CCGGGTGCTGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-312s21c1
Sequence:CCGGAGCGGAGACTAAGGGACATTCCTCGAGGAATGTCCCTTAGTCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-1070s21c1
Sequence:CCGGGAGGAGACCATCCGCATTTACCTCGAGGTAAATGCGGATGGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-582s21c1
Sequence:CCGGTACTCACCAAGTACAAGATTACTCGAGTAATCTTGTACTTGGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1909s1c1
Sequence:CCGGCGGCCCATTTACCAACTTCAACTCGAGTTGAAGTTGGTAAATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-286s1c1
Sequence:CCGGCCGCAAGTATGCACTGAACATCTCGAGATGTTCAGTGCATACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1507s1c1
Sequence:CCGGGCTGATGATCTTCGACTTCATCTCGAGATGAAGTCGAAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172476.2-2211s1c1
Sequence:CCGGGCCCGAAACTTCTCAACACATCTCGAGATGTGTTGAGAAGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-815s1c1
Sequence:CCGGGCTTACTTGATAAGCACGATTCTCGAGAATCGTGCTTATCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172476
TMC7 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-527s21c1
Sequence:CCGGGTGCTGAACCTGGTGATATTCCTCGAGGAATATCACCAGGTTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-312s21c1
Sequence:CCGGAGCGGAGACTAAGGGACATTCCTCGAGGAATGTCCCTTAGTCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-1070s21c1
Sequence:CCGGGAGGAGACCATCCGCATTTACCTCGAGGTAAATGCGGATGGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172476.4-582s21c1
Sequence:CCGGTACTCACCAAGTACAAGATTACTCGAGTAATCTTGTACTTGGTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1909s1c1
Sequence:CCGGCGGCCCATTTACCAACTTCAACTCGAGTTGAAGTTGGTAAATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-286s1c1
Sequence:CCGGCCGCAAGTATGCACTGAACATCTCGAGATGTTCAGTGCATACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-1507s1c1
Sequence:CCGGGCTGATGATCTTCGACTTCATCTCGAGATGAAGTCGAAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172476.2-2211s1c1
Sequence:CCGGGCCCGAAACTTCTCAACACATCTCGAGATGTGTTGAGAAGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172476.2-815s1c1
Sequence:CCGGGCTTACTTGATAAGCACGATTCTCGAGAATCGTGCTTATCAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024847
TMC7 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1040s21c1
Sequence:CCGGAGTTACTGCAACAAGATATTTCTCGAGAAATATCTTGTTGCAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2607s21c1
Sequence:CCGGGTATTTGAGCCACGAGTTTATCTCGAGATAAACTCGTGGCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2452s21c1
Sequence:CCGGACCTAACCCAGCCCTTAATTACTCGAGTAATTAAGGGCTGGGTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1346s21c1
Sequence:CCGGATATTGTATCTACCGTCTATTCTCGAGAATAGACGGTAGATACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-165s1c1
Sequence:CCGGCCTGTGAACTTCCTCCAAGAACTCGAGTTCTTGGAGGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-620s1c1
Sequence:CCGGCCCAGTCTTACTCACGAAATACTCGAGTATTTCGTGAGTAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-1322s1c1
Sequence:CCGGCCCAATGATCTTTGCCAAGATCTCGAGATCTTGGCAAAGATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-529s1c1
Sequence:CCGGGCACTGGGATTCAGTCCTATTCTCGAGAATAGGACTGAATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-2182s1c1
Sequence:CCGGGCTACCTAATCCAGAAACTAACTCGAGTTAGTTTCTGGATTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024847
TMC7 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1040s21c1
Sequence:CCGGAGTTACTGCAACAAGATATTTCTCGAGAAATATCTTGTTGCAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2607s21c1
Sequence:CCGGGTATTTGAGCCACGAGTTTATCTCGAGATAAACTCGTGGCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2452s21c1
Sequence:CCGGACCTAACCCAGCCCTTAATTACTCGAGTAATTAAGGGCTGGGTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1346s21c1
Sequence:CCGGATATTGTATCTACCGTCTATTCTCGAGAATAGACGGTAGATACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-165s1c1
Sequence:CCGGCCTGTGAACTTCCTCCAAGAACTCGAGTTCTTGGAGGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-620s1c1
Sequence:CCGGCCCAGTCTTACTCACGAAATACTCGAGTATTTCGTGAGTAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-1322s1c1
Sequence:CCGGCCCAATGATCTTTGCCAAGATCTCGAGATCTTGGCAAAGATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-529s1c1
Sequence:CCGGGCACTGGGATTCAGTCCTATTCTCGAGAATAGGACTGAATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-2182s1c1
Sequence:CCGGGCTACCTAATCCAGAAACTAACTCGAGTTAGTTTCTGGATTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024847
TMC7 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1040s21c1
Sequence:CCGGAGTTACTGCAACAAGATATTTCTCGAGAAATATCTTGTTGCAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2607s21c1
Sequence:CCGGGTATTTGAGCCACGAGTTTATCTCGAGATAAACTCGTGGCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024847.3-2452s21c1
Sequence:CCGGACCTAACCCAGCCCTTAATTACTCGAGTAATTAAGGGCTGGGTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024847.3-1346s21c1
Sequence:CCGGATATTGTATCTACCGTCTATTCTCGAGAATAGACGGTAGATACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-165s1c1
Sequence:CCGGCCTGTGAACTTCCTCCAAGAACTCGAGTTCTTGGAGGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-620s1c1
Sequence:CCGGCCCAGTCTTACTCACGAAATACTCGAGTATTTCGTGAGTAAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-1322s1c1
Sequence:CCGGCCCAATGATCTTTGCCAAGATCTCGAGATCTTGGCAAAGATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-529s1c1
Sequence:CCGGGCACTGGGATTCAGTCCTATTCTCGAGAATAGGACTGAATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024847.2-2182s1c1
Sequence:CCGGGCTACCTAATCCAGAAACTAACTCGAGTTAGTTTCTGGATTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks