EMAIL THIS PAGE TO A FRIEND

TMC8

transmembrane channel-like 8

Synonyms: EV2 EVER2 EVIN2
UniProtKB ID: Q8IU68, Q2YDC0, Q8IWU7, Q8N358, Q8NF04
Gene ID:
Human(147138) Summary: Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Mouse(217356) transmembrane channel-like gene family 8
Rat(688276) transmembrane channel-like 8
cow(513813) transmembrane channel-like 8
sheep(101114540) transmembrane channel-like 8
naked mole-rat(101698806) transmembrane channel-like 8
domestic guinea pig(100724540) transmembrane channel-like 8
domestic cat(101080594) transmembrane channel-like 8
dog(483342) transmembrane channel-like 8
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152468 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152468 Rosetta Predictions human pricing
NM_001126301 Rosetta Predictions rat pricing
NM_181856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130261 predicted 1100
2 SASI_Hs01_00130263 predicted 874
3 SASI_Hs01_00130264 predicted 960
4 SASI_Hs01_00130265 predicted 1606
5 SASI_Hs01_00130266 predicted 1485
6 SASI_Hs01_00130267 predicted 1599
7 SASI_Hs01_00130268 predicted 493
8 SASI_Hs01_00130269 predicted 1101
9 SASI_Hs01_00130270 predicted 1168
10 SASI_Hs02_00366245 predicted 927
11 SASI_Hs01_00130262 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253383 predicted 1869
2 SASI_Rn02_00253384 predicted 978
3 SASI_Rn02_00253385 predicted 825
4 SASI_Rn02_00253386 predicted 1088
5 SASI_Rn02_00253387 predicted 1618
6 SASI_Rn02_00253388 predicted 1636
7 SASI_Rn02_00253389 predicted 261
8 SASI_Rn02_00253390 predicted 933
9 SASI_Rn02_00253391 predicted 1418
10 SASI_Rn02_00253392 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065126 predicted 1473
2 SASI_Mm01_00065127 predicted 1088
3 SASI_Mm01_00065128 predicted 760
4 SASI_Mm01_00065129 predicted 859
5 SASI_Mm01_00065130 predicted 1152
6 SASI_Mm01_00065131 predicted 1322
7 SASI_Mm01_00065132 predicted 1523
8 SASI_Mm01_00065133 predicted 997
9 SASI_Mm01_00065134 predicted 1425
10 SASI_Mm01_00065135 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181856
TMC8 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-563s1c1
Sequence:CCGGCAAGGTTTCACAACCCACTTTCTCGAGAAAGTGGGTTGTGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1757s1c1
Sequence:CCGGGTGGCCTCTTCACAAACTATTCTCGAGAATAGTTTGTGAAGAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-609s1c1
Sequence:CCGGCAACAACACCTATCTCTTCTACTCGAGTAGAAGAGATAGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1128s1c1
Sequence:CCGGCCAATTGTTCACAGTCCTGATCTCGAGATCAGGACTGTGAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181856
TMC8 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-563s1c1
Sequence:CCGGCAAGGTTTCACAACCCACTTTCTCGAGAAAGTGGGTTGTGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1757s1c1
Sequence:CCGGGTGGCCTCTTCACAAACTATTCTCGAGAATAGTTTGTGAAGAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-609s1c1
Sequence:CCGGCAACAACACCTATCTCTTCTACTCGAGTAGAAGAGATAGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1128s1c1
Sequence:CCGGCCAATTGTTCACAGTCCTGATCTCGAGATCAGGACTGTGAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181856
TMC8 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-563s1c1
Sequence:CCGGCAAGGTTTCACAACCCACTTTCTCGAGAAAGTGGGTTGTGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1757s1c1
Sequence:CCGGGTGGCCTCTTCACAAACTATTCTCGAGAATAGTTTGTGAAGAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-609s1c1
Sequence:CCGGCAACAACACCTATCTCTTCTACTCGAGTAGAAGAGATAGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181856.1-1128s1c1
Sequence:CCGGCCAATTGTTCACAGTCCTGATCTCGAGATCAGGACTGTGAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152468
TMC8 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1164s1c1
Sequence:CCGGGCATGAGATCAGCAACGAGTTCTCGAGAACTCGTTGCTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1599s1c1
Sequence:CCGGCGGCTACAACGTTTGTGACTACTCGAGTAGTCACAAACGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-2062s1c1
Sequence:CCGGCTCTTCACCAACTACTCAGCACTCGAGTGCTGAGTAGTTGGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-918s1c1
Sequence:CCGGCTATCTCTTCTACGGTGCGTACTCGAGTACGCACCGTAGAAGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-872s1c1
Sequence:CCGGACAATCAACTTTGGCATGTTTCTCGAGAAACATGCCAAAGTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152468.4-510s21c1
Sequence:CCGGTGATGGACAAGCGCCTCATCTCTCGAGAGATGAGGCGCTTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2867s21c1
Sequence:CCGGGAGCCATGAGTGCAATTTATACTCGAGTATAAATTGCACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2840s21c1
Sequence:CCGGTAGAATGTGTTCTGCTGATTTCTCGAGAAATCAGCAGAACACATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2815s21c1
Sequence:CCGGAGTATCTCTTGAATGCGATTTCTCGAGAAATCGCATTCAAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152468
TMC8 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1164s1c1
Sequence:CCGGGCATGAGATCAGCAACGAGTTCTCGAGAACTCGTTGCTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1599s1c1
Sequence:CCGGCGGCTACAACGTTTGTGACTACTCGAGTAGTCACAAACGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-2062s1c1
Sequence:CCGGCTCTTCACCAACTACTCAGCACTCGAGTGCTGAGTAGTTGGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-918s1c1
Sequence:CCGGCTATCTCTTCTACGGTGCGTACTCGAGTACGCACCGTAGAAGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-872s1c1
Sequence:CCGGACAATCAACTTTGGCATGTTTCTCGAGAAACATGCCAAAGTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152468.4-510s21c1
Sequence:CCGGTGATGGACAAGCGCCTCATCTCTCGAGAGATGAGGCGCTTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2867s21c1
Sequence:CCGGGAGCCATGAGTGCAATTTATACTCGAGTATAAATTGCACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2840s21c1
Sequence:CCGGTAGAATGTGTTCTGCTGATTTCTCGAGAAATCAGCAGAACACATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2815s21c1
Sequence:CCGGAGTATCTCTTGAATGCGATTTCTCGAGAAATCGCATTCAAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152468
TMC8 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1164s1c1
Sequence:CCGGGCATGAGATCAGCAACGAGTTCTCGAGAACTCGTTGCTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-1599s1c1
Sequence:CCGGCGGCTACAACGTTTGTGACTACTCGAGTAGTCACAAACGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-2062s1c1
Sequence:CCGGCTCTTCACCAACTACTCAGCACTCGAGTGCTGAGTAGTTGGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-918s1c1
Sequence:CCGGCTATCTCTTCTACGGTGCGTACTCGAGTACGCACCGTAGAAGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152468.3-872s1c1
Sequence:CCGGACAATCAACTTTGGCATGTTTCTCGAGAAACATGCCAAAGTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152468.4-510s21c1
Sequence:CCGGTGATGGACAAGCGCCTCATCTCTCGAGAGATGAGGCGCTTGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2867s21c1
Sequence:CCGGGAGCCATGAGTGCAATTTATACTCGAGTATAAATTGCACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2840s21c1
Sequence:CCGGTAGAATGTGTTCTGCTGATTTCTCGAGAAATCAGCAGAACACATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152468.4-2815s21c1
Sequence:CCGGAGTATCTCTTGAATGCGATTTCTCGAGAAATCGCATTCAAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks