EMAIL THIS PAGE TO A FRIEND

TMCC1

transmembrane and coiled-coil domain family 1

UniProtKB ID: O94876, Q68E06, Q8IXM8
Gene ID:
Mouse(330401) transmembrane and coiled coil domains 1
Rat(312654) transmembrane and coiled-coil domain family 1
chicken(416125) transmembrane and coiled-coil domain family 1
Horse(100050815) transmembrane and coiled-coil domain family 1
domestic cat(101098852) transmembrane and coiled-coil domain family 1
dog(484644) transmembrane and coiled-coil domain family 1
domestic guinea pig(100721390) transmembrane and coiled-coil domain family 1
naked mole-rat(101697366) transmembrane and coiled-coil domain family 1
Domestic Rabbit(100346710) transmembrane and coiled-coil domain family 1
cow(510486) transmembrane and coiled-coil domain family 1
sheep(101122729) transmembrane and coiled-coil domain family 1
271 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44707 Anti-TMCC1 antibody produced in rabbit affinity isolated antibody , zebrafish, bovine, mouse, rat, human, guinea pig, horse, rabbit,
western blot pricing
SAB2103544 Anti-TMCC1 antibody produced in rabbit affinity isolated antibody rat, horse, mouse, rabbit, guinea pig, zebrafish, human, bovine
western blot pricing
SAB2103813 Anti-TMCC1 antibody produced in rabbit affinity isolated antibody mouse, human, bovine, rat, rabbit, zebrafish, guinea pig, horse
western blot pricing
HPA053894 Anti-TMCC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015008 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017395 Rosetta Predictions human pricing
NM_001128224 Rosetta Predictions human pricing
NM_015008 Rosetta Predictions human pricing
XM_001054467 Rosetta Predictions rat pricing
XM_232287 Rosetta Predictions rat pricing
XM_892747 Rosetta Predictions mouse pricing
XM_917443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034764 predicted 2607
2 SASI_Hs01_00034765 predicted 1781
3 SASI_Hs01_00034766 predicted 1756
4 SASI_Hs01_00034767 predicted 1798
5 SASI_Hs01_00034768 predicted 1507
6 SASI_Hs01_00034769 predicted 1777
7 SASI_Hs01_00034770 predicted 2712
8 SASI_Hs01_00034771 predicted 1761
9 SASI_Hs01_00034772 predicted 1454
10 SASI_Hs02_00306724 predicted 1746
11 SASI_Hs01_00034773 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330956 predicted 1233
2 SASI_Hs02_00330957 predicted 990
3 SASI_Hs02_00330958 predicted 1246
4 SASI_Hs02_00330959 predicted 671
5 SASI_Hs02_00330960 predicted 1251
6 SASI_Hs02_00330961 predicted 1842
7 SASI_Hs02_00330962 predicted 1872
8 SASI_Hs02_00330963 predicted 1839
9 SASI_Hs02_00330964 predicted 924
10 SASI_Hs02_00330965 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174099 predicted 1758
2 SASI_Hs01_00174100 predicted 926
3 SASI_Hs01_00174101 predicted 901
4 SASI_Hs01_00174102 predicted 948
5 SASI_Hs01_00174103 predicted 656
6 SASI_Hs01_00174104 predicted 922
7 SASI_Hs01_00174105 predicted 1858
8 SASI_Hs01_00174106 predicted 909
9 SASI_Hs01_00174107 predicted 596
10 SASI_Hs02_00346778 predicted 895
11 SASI_Hs01_00174108 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275898 predicted 1620
2 SASI_Rn02_00275899 predicted 1242
3 SASI_Rn02_00275900 predicted 2132
4 SASI_Rn02_00275901 predicted 973
5 SASI_Rn02_00275902 predicted 684
6 SASI_Rn02_00275903 predicted 253
7 SASI_Rn02_00275904 predicted 618
8 SASI_Rn02_00275905 predicted 2158
9 SASI_Rn02_00275906 predicted 593
10 SASI_Rn02_00275907 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387041 predicted 1615
2 SASI_Rn02_00387042 predicted 1241
3 SASI_Rn02_00387043 predicted 2129
4 SASI_Rn02_00387044 predicted 976
5 SASI_Rn02_00387045 predicted 686
6 SASI_Rn02_00387046 predicted 254
7 SASI_Rn02_00387047 predicted 610
8 SASI_Rn02_00387048 predicted 2159
9 SASI_Rn02_00387049 predicted 589
10 SASI_Rn02_00387050 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259748 predicted 1286
2 SASI_Mm01_00259749 predicted 1250
3 SASI_Mm01_00259750 predicted 975
4 SASI_Mm01_00259751 predicted 683
5 SASI_Mm02_00429209 predicted 2143
6 SASI_Mm01_00259752 predicted 1780
7 SASI_Mm01_00259753 predicted 1397
8 SASI_Mm02_00429210 predicted 2170
9 SASI_Mm01_00259754 predicted 940
10 SASI_Mm01_00259756 predicted 1753
11 SASI_Mm01_00259755 predicted 1236
12 SASI_Mm01_00259757 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441176 predicted 1292
2 SASI_Mm02_00441177 predicted 1244
3 SASI_Mm02_00441178 predicted 976
4 SASI_Mm02_00441179 predicted 692
5 SASI_Mm02_00441180 predicted 2139
6 SASI_Mm02_00441181 predicted 1783
7 SASI_Mm02_00441182 predicted 1402
8 SASI_Mm02_00441183 predicted 2170
9 SASI_Mm02_00441184 predicted 939
10 SASI_Mm02_00441185 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177412
TMCC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000367286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1778s21c1
Sequence:CCGGCCTTACAGGAAGAGCGGTATACTCGAGTATACCGCTCTTCCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1447s21c1
Sequence:CCGGCCTAACCTGAAAGACTCATTACTCGAGTAATGAGTCTTTCAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177412.1-2553s21c1
Sequence:CCGGAGCTTGGAGAACTGCACTAAACTCGAGTTTAGTGCAGTTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177412
TMCC1 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000367286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1778s21c1
Sequence:CCGGCCTTACAGGAAGAGCGGTATACTCGAGTATACCGCTCTTCCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1447s21c1
Sequence:CCGGCCTAACCTGAAAGACTCATTACTCGAGTAATGAGTCTTTCAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177412.1-2553s21c1
Sequence:CCGGAGCTTGGAGAACTGCACTAAACTCGAGTTTAGTGCAGTTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177412
TMCC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000367286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1778s21c1
Sequence:CCGGCCTTACAGGAAGAGCGGTATACTCGAGTATACCGCTCTTCCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177412.1-1447s21c1
Sequence:CCGGCCTAACCTGAAAGACTCATTACTCGAGTAATGAGTCTTTCAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177412.1-2553s21c1
Sequence:CCGGAGCTTGGAGAACTGCACTAAACTCGAGTTTAGTGCAGTTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015008
VALIDATED
TMCC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-659s1c1
Sequence:CCGGGACTCTTTAGAGGAAGGGCAACTCGAGTTGCCCTTCCTCTAAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1356s1c1
Sequence:CCGGGCACTTTATTCCTTGTGGTTTCTCGAGAAACCACAAGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-601s1c1
Sequence:CCGGGATTGCCTCACTCATTCGGAACTCGAGTTCCGAATGAGTGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1345s1c1
Sequence:CCGGCAGGACGTTCAGCACTTTATTCTCGAGAATAAAGTGCTGAACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-941s1c1
Sequence:CCGGGAACATTATCAGAGGGACTATCTCGAGATAGTCCCTCTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-1013s1c1
Sequence:CCGGGAAGAACAGCTAAATGACCTACTCGAGTAGGTCATTTAGCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1007s1c1
Sequence:CCGGCGATTGGAAGAACAGCTAAATCTCGAGATTTAGCTGTTCTTCCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-521s1c1
Sequence:CCGGGATAGTGTCAAAGGTGGGTTTCTCGAGAAACCCACCTTTGACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-714s1c1
Sequence:CCGGCAAACTTTCAGTCTAGCCCAACTCGAGTTGGGCTAGACTGAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015008
VALIDATED
TMCC1 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-659s1c1
Sequence:CCGGGACTCTTTAGAGGAAGGGCAACTCGAGTTGCCCTTCCTCTAAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1356s1c1
Sequence:CCGGGCACTTTATTCCTTGTGGTTTCTCGAGAAACCACAAGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-601s1c1
Sequence:CCGGGATTGCCTCACTCATTCGGAACTCGAGTTCCGAATGAGTGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1345s1c1
Sequence:CCGGCAGGACGTTCAGCACTTTATTCTCGAGAATAAAGTGCTGAACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-941s1c1
Sequence:CCGGGAACATTATCAGAGGGACTATCTCGAGATAGTCCCTCTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-1013s1c1
Sequence:CCGGGAAGAACAGCTAAATGACCTACTCGAGTAGGTCATTTAGCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1007s1c1
Sequence:CCGGCGATTGGAAGAACAGCTAAATCTCGAGATTTAGCTGTTCTTCCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-521s1c1
Sequence:CCGGGATAGTGTCAAAGGTGGGTTTCTCGAGAAACCCACCTTTGACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-714s1c1
Sequence:CCGGCAAACTTTCAGTCTAGCCCAACTCGAGTTGGGCTAGACTGAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015008
VALIDATED
TMCC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-659s1c1
Sequence:CCGGGACTCTTTAGAGGAAGGGCAACTCGAGTTGCCCTTCCTCTAAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1356s1c1
Sequence:CCGGGCACTTTATTCCTTGTGGTTTCTCGAGAAACCACAAGGAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-601s1c1
Sequence:CCGGGATTGCCTCACTCATTCGGAACTCGAGTTCCGAATGAGTGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1345s1c1
Sequence:CCGGCAGGACGTTCAGCACTTTATTCTCGAGAATAAAGTGCTGAACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015008.1-941s1c1
Sequence:CCGGGAACATTATCAGAGGGACTATCTCGAGATAGTCCCTCTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-1013s1c1
Sequence:CCGGGAAGAACAGCTAAATGACCTACTCGAGTAGGTCATTTAGCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015008.1-1007s1c1
Sequence:CCGGCGATTGGAAGAACAGCTAAATCTCGAGATTTAGCTGTTCTTCCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-521s1c1
Sequence:CCGGGATAGTGTCAAAGGTGGGTTTCTCGAGAAACCCACCTTTGACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015008.1-714s1c1
Sequence:CCGGCAAACTTTCAGTCTAGCCCAACTCGAGTTGGGCTAGACTGAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks