EMAIL THIS PAGE TO A FRIEND

TMCC2

transmembrane and coiled-coil domain family 2

Synonyms: HUCEP11
UniProtKB ID: O75069, A2RRH3, B7Z1P7, Q6ZN09
Gene ID:
Mouse(68875) transmembrane and coiled-coil domains 2
Rat(305095) transmembrane and coiled-coil domain family 2
Zebrafish(560064) transmembrane and coiled-coil domain family 2
dog(488569) transmembrane and coiled-coil domain family 2
domestic cat(101084510) transmembrane and coiled-coil domain family 2
chicken(419827) transmembrane and coiled-coil domain family 2
cow(768080) transmembrane and coiled-coil domain family 2
sheep(101109819) transmembrane and coiled-coil domain family 2
naked mole-rat(101710754) transmembrane and coiled-coil domain family 2
domestic guinea pig(100720994) transmembrane and coiled-coil domain family 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108729 Anti-TMCC2 affinity isolated antibody human, mouse, bovine, bovine, guinea pig, rabbit, rat
western blot pricing
HPA014254 Anti-TMCC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2102445 Anti-TMCC2 antibody produced in rabbit affinity isolated antibody human, guinea pig, mouse, bovine, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072591 MISSION® esiRNA esiRNA human TMCC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014858 Rosetta Predictions human pricing
XM_001059693 Rosetta Predictions rat pricing
XM_223107 Rosetta Predictions rat pricing
NM_178874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181391 predicted 690
2 SASI_Hs01_00181392 predicted 624
3 SASI_Hs01_00181393 predicted 672
4 SASI_Hs01_00181394 predicted 2999
5 SASI_Hs01_00181395 predicted 1963
6 SASI_Hs01_00181396 predicted 1752
7 SASI_Hs01_00181398 predicted 1432
8 SASI_Hs01_00181399 predicted 2372
9 SASI_Hs01_00181400 predicted 1754
10 SASI_Hs02_00346438 predicted 2884
11 SASI_Hs01_00181397 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293988 predicted 2699
2 SASI_Rn02_00293989 predicted 1595
3 SASI_Rn02_00293990 predicted 709
4 SASI_Rn02_00293991 predicted 2714
5 SASI_Rn02_00293992 predicted 2725
6 SASI_Rn02_00293993 predicted 1768
7 SASI_Rn02_00293994 predicted 591
8 SASI_Rn02_00293995 predicted 1486
9 SASI_Rn02_00293996 predicted 1577
10 SASI_Rn02_00293997 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381129 predicted 2698
2 SASI_Rn02_00381130 predicted 1589
3 SASI_Rn02_00381131 predicted 711
4 SASI_Rn02_00381132 predicted 2713
5 SASI_Rn02_00381133 predicted 2721
6 SASI_Rn02_00381134 predicted 1768
7 SASI_Rn02_00381135 predicted 593
8 SASI_Rn02_00381136 predicted 1481
9 SASI_Rn02_00381137 predicted 1572
10 SASI_Rn02_00381138 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124169 predicted 273
2 SASI_Mm01_00124170 predicted 2456
3 SASI_Mm01_00124172 predicted 2518
4 SASI_Mm01_00124173 predicted 536
5 SASI_Mm01_00124174 predicted 949
6 SASI_Mm01_00124175 predicted 1307
7 SASI_Mm01_00124176 predicted 2012
8 SASI_Mm01_00124177 predicted 1752
9 SASI_Mm01_00124178 predicted 323
10 SASI_Mm02_00349457 predicted 1813
11 SASI_Mm01_00124171 predicted 1981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014858
TMCC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-2157s1c1
Sequence:CCGGCCTGACTGAGCTTCATCAGAACTCGAGTTCTGATGAAGCTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-1749s1c1
Sequence:CCGGGTTTGGCAGTGCTGACAACATCTCGAGATGTTGTCAGCACTGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1375s1c1
Sequence:CCGGGACGACAATGTGGCAGAGTATCTCGAGATACTCTGCCACATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-2175s1c1
Sequence:CCGGGAACGAGATGACGAACCTGAACTCGAGTTCAGGTTCGTCATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1443s1c1
Sequence:CCGGGCAAGTGTTCGAGAAGAAGAACTCGAGTTCTTCTTCTCGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1954s1c1
Sequence:CCGGCCTAAGTCCAATGCACTGTATCTCGAGATACAGTGCATTGGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1320s1c1
Sequence:CCGGGCACCAGAAGATCCTGAAGATCTCGAGATCTTCAGGATCTTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-627s21c1
Sequence:CCGGCCGAAGCAAGCCTCCTGATTTCTCGAGAAATCAGGAGGCTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-1342s21c1
Sequence:CCGGACCGAGCAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014858
TMCC2 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-2157s1c1
Sequence:CCGGCCTGACTGAGCTTCATCAGAACTCGAGTTCTGATGAAGCTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-1749s1c1
Sequence:CCGGGTTTGGCAGTGCTGACAACATCTCGAGATGTTGTCAGCACTGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1375s1c1
Sequence:CCGGGACGACAATGTGGCAGAGTATCTCGAGATACTCTGCCACATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-2175s1c1
Sequence:CCGGGAACGAGATGACGAACCTGAACTCGAGTTCAGGTTCGTCATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1443s1c1
Sequence:CCGGGCAAGTGTTCGAGAAGAAGAACTCGAGTTCTTCTTCTCGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1954s1c1
Sequence:CCGGCCTAAGTCCAATGCACTGTATCTCGAGATACAGTGCATTGGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1320s1c1
Sequence:CCGGGCACCAGAAGATCCTGAAGATCTCGAGATCTTCAGGATCTTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-627s21c1
Sequence:CCGGCCGAAGCAAGCCTCCTGATTTCTCGAGAAATCAGGAGGCTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-1342s21c1
Sequence:CCGGACCGAGCAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014858
TMCC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-2157s1c1
Sequence:CCGGCCTGACTGAGCTTCATCAGAACTCGAGTTCTGATGAAGCTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014858.2-1749s1c1
Sequence:CCGGGTTTGGCAGTGCTGACAACATCTCGAGATGTTGTCAGCACTGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1375s1c1
Sequence:CCGGGACGACAATGTGGCAGAGTATCTCGAGATACTCTGCCACATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-2175s1c1
Sequence:CCGGGAACGAGATGACGAACCTGAACTCGAGTTCAGGTTCGTCATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1443s1c1
Sequence:CCGGGCAAGTGTTCGAGAAGAAGAACTCGAGTTCTTCTTCTCGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1954s1c1
Sequence:CCGGCCTAAGTCCAATGCACTGTATCTCGAGATACAGTGCATTGGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014858.2-1320s1c1
Sequence:CCGGGCACCAGAAGATCCTGAAGATCTCGAGATCTTCAGGATCTTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-627s21c1
Sequence:CCGGCCGAAGCAAGCCTCCTGATTTCTCGAGAAATCAGGAGGCTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014858.2-1342s21c1
Sequence:CCGGACCGAGCAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178874
VALIDATED
TMCC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1599s1c1
Sequence:CCGGCCGAGATCCAACACTCTTTATCTCGAGATAAAGAGTGTTGGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-2458s1c1
Sequence:CCGGCCAGGGCTGCATTATTTGAATCTCGAGATTCAAATAATGCAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-534s1c1
Sequence:CCGGACTGCTTTCAACCGGGTGTTACTCGAGTAACACCCGGTTGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1817s1c1
Sequence:CCGGCCAGAATGAAATGACCAACCTCTCGAGAGGTTGGTCATTTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-935s1c1
Sequence:CCGGCCAGCGAACTAAGGCTGCCATCTCGAGATGGCAGCCTTAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-1208s21c1
Sequence:CCGGCAAGGATGTGCTACGCGATATCTCGAGATATCGCGTAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-663s21c1
Sequence:CCGGAGTCCTCACCTGCTTCGTAAGCTCGAGCTTACGAAGCAGGTGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-319s21c1
Sequence:CCGGTCTCAGAGGGCTCCATGTTTGCTCGAGCAAACATGGAGCCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-283s21c1
Sequence:CCGGGAAGCAAGCCTCCTGATTTAACTCGAGTTAAATCAGGAGGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-982s21c1
Sequence:CCGGAGATCACTGAGCAGATCAAGACTCGAGTCTTGATCTGCTCAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2517s21c1
Sequence:CCGGAGGATGCTCTAGTCATGTAAGCTCGAGCTTACATGACTAGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2421s21c1
Sequence:CCGGAGGGACACTCTCAGCCAAATGCTCGAGCATTTGGCTGAGAGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2609s21c1
Sequence:CCGGCCATGGAGATGGTCTGGATAACTCGAGTTATCCAGACCATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178874
VALIDATED
TMCC2 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1599s1c1
Sequence:CCGGCCGAGATCCAACACTCTTTATCTCGAGATAAAGAGTGTTGGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-2458s1c1
Sequence:CCGGCCAGGGCTGCATTATTTGAATCTCGAGATTCAAATAATGCAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-534s1c1
Sequence:CCGGACTGCTTTCAACCGGGTGTTACTCGAGTAACACCCGGTTGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1817s1c1
Sequence:CCGGCCAGAATGAAATGACCAACCTCTCGAGAGGTTGGTCATTTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-935s1c1
Sequence:CCGGCCAGCGAACTAAGGCTGCCATCTCGAGATGGCAGCCTTAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-1208s21c1
Sequence:CCGGCAAGGATGTGCTACGCGATATCTCGAGATATCGCGTAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-663s21c1
Sequence:CCGGAGTCCTCACCTGCTTCGTAAGCTCGAGCTTACGAAGCAGGTGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-319s21c1
Sequence:CCGGTCTCAGAGGGCTCCATGTTTGCTCGAGCAAACATGGAGCCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-283s21c1
Sequence:CCGGGAAGCAAGCCTCCTGATTTAACTCGAGTTAAATCAGGAGGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-982s21c1
Sequence:CCGGAGATCACTGAGCAGATCAAGACTCGAGTCTTGATCTGCTCAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2517s21c1
Sequence:CCGGAGGATGCTCTAGTCATGTAAGCTCGAGCTTACATGACTAGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2421s21c1
Sequence:CCGGAGGGACACTCTCAGCCAAATGCTCGAGCATTTGGCTGAGAGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2609s21c1
Sequence:CCGGCCATGGAGATGGTCTGGATAACTCGAGTTATCCAGACCATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178874
VALIDATED
TMCC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1599s1c1
Sequence:CCGGCCGAGATCCAACACTCTTTATCTCGAGATAAAGAGTGTTGGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-2458s1c1
Sequence:CCGGCCAGGGCTGCATTATTTGAATCTCGAGATTCAAATAATGCAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-534s1c1
Sequence:CCGGACTGCTTTCAACCGGGTGTTACTCGAGTAACACCCGGTTGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-1817s1c1
Sequence:CCGGCCAGAATGAAATGACCAACCTCTCGAGAGGTTGGTCATTTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178874.2-935s1c1
Sequence:CCGGCCAGCGAACTAAGGCTGCCATCTCGAGATGGCAGCCTTAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-1208s21c1
Sequence:CCGGCAAGGATGTGCTACGCGATATCTCGAGATATCGCGTAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-663s21c1
Sequence:CCGGAGTCCTCACCTGCTTCGTAAGCTCGAGCTTACGAAGCAGGTGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-319s21c1
Sequence:CCGGTCTCAGAGGGCTCCATGTTTGCTCGAGCAAACATGGAGCCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-283s21c1
Sequence:CCGGGAAGCAAGCCTCCTGATTTAACTCGAGTTAAATCAGGAGGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178874.2-982s21c1
Sequence:CCGGAGATCACTGAGCAGATCAAGACTCGAGTCTTGATCTGCTCAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2517s21c1
Sequence:CCGGAGGATGCTCTAGTCATGTAAGCTCGAGCTTACATGACTAGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2421s21c1
Sequence:CCGGAGGGACACTCTCAGCCAAATGCTCGAGCATTTGGCTGAGAGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178874.2-2609s21c1
Sequence:CCGGCCATGGAGATGGTCTGGATAACTCGAGTTATCCAGACCATCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks