EMAIL THIS PAGE TO A FRIEND

TMCC3

transmembrane and coiled-coil domain family 3

UniProtKB ID: Q9ULS5, Q8IWB2
Gene ID:
Mouse(319880) transmembrane and coiled coil domains 3
Rat(314751) transmembrane and coiled-coil domain family 3
domestic guinea pig(100725867) transmembrane and coiled-coil domain family 3
naked mole-rat(101711640) transmembrane and coiled-coil domain family 3
Domestic Rabbit(100347140) transmembrane and coiled-coil domain family 3
cow(509239) transmembrane and coiled-coil domain family 3
sheep(101116038) transmembrane and coiled-coil domain family 3
Zebrafish(556763) transmembrane and coiled-coil domain family 3
domestic cat(101091031) transmembrane and coiled-coil domain family 3
dog(482607) transmembrane and coiled-coil domain family 3
chicken(417905) transmembrane and coiled-coil domain family 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0552 AQUA Peptide EQQALQTV(CM-Cys)L[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020698 Rosetta Predictions human pricing
NM_001108084 Rosetta Predictions rat pricing
NM_172051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155920 predicted 1506
2 SASI_Hs02_00353692 predicted 794
3 SASI_Hs01_00155921 predicted 1502
4 SASI_Hs01_00155923 predicted 369
5 SASI_Hs01_00155924 predicted 505
6 SASI_Hs01_00155925 predicted 908
7 SASI_Hs01_00155926 predicted 388
8 SASI_Hs01_00155927 predicted 514
9 SASI_Hs01_00155928 predicted 505
10 SASI_Hs01_00155929 predicted 692
11 SASI_Hs01_00155922 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235194 predicted 820
2 SASI_Rn02_00235195 predicted 1570
3 SASI_Rn02_00235196 predicted 1472
4 SASI_Rn02_00235197 predicted 763
5 SASI_Rn02_00235198 predicted 912
6 SASI_Rn02_00235199 predicted 1442
7 SASI_Rn02_00235200 predicted 248
8 SASI_Rn02_00235201 predicted 582
9 SASI_Rn02_00235202 predicted 790
10 SASI_Rn02_00235203 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041894 predicted 1128
2 SASI_Mm01_00041895 predicted 1531
3 SASI_Mm01_00041896 predicted 794
4 SASI_Mm01_00041897 predicted 595
5 SASI_Mm01_00041898 predicted 1654
6 SASI_Mm02_00343645 predicted 320
7 SASI_Mm01_00041899 predicted 1142
8 SASI_Mm01_00041900 predicted 798
9 SASI_Mm01_00041901 predicted 906
10 SASI_Mm01_00041902 predicted 533
11 SASI_Mm01_00041893 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020698
VALIDATED
TMCC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020698.2-1261s21c1
Sequence:CCGCATCCTGCCAGACTCGCATTTCCTCGAGGAAATGCGAGTCTGGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020698.2-1837s21c1
Sequence:CCGGTATTGAGACCTTGGCATAATTCTCGAGAATTATGCCAAGGTCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-3938s1c1
Sequence:CCGGGCCTAGCAAATGTGCTTTAATCTCGAGATTAAAGCACATTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-4339s1c1
Sequence:CCGGCCACTGTTTGTTCTCTTCAATCTCGAGATTGAAGAGAACAAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020698.1-203s1c1
Sequence:CCGGCGTCATGACATGAATACCTTACTCGAGTAAGGTATTCATGTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-386s1c1
Sequence:CCGGGATGGGAATGTTGCGGAGTATCTCGAGATACTCCGCAACATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-769s1c1
Sequence:CCGGCGACAACATTGCTCACTTGAACTCGAGTTCAAGTGAGCAATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020698
VALIDATED
TMCC3 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020698.2-1261s21c1
Sequence:CCGCATCCTGCCAGACTCGCATTTCCTCGAGGAAATGCGAGTCTGGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020698.2-1837s21c1
Sequence:CCGGTATTGAGACCTTGGCATAATTCTCGAGAATTATGCCAAGGTCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-3938s1c1
Sequence:CCGGGCCTAGCAAATGTGCTTTAATCTCGAGATTAAAGCACATTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-4339s1c1
Sequence:CCGGCCACTGTTTGTTCTCTTCAATCTCGAGATTGAAGAGAACAAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020698.1-203s1c1
Sequence:CCGGCGTCATGACATGAATACCTTACTCGAGTAAGGTATTCATGTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-386s1c1
Sequence:CCGGGATGGGAATGTTGCGGAGTATCTCGAGATACTCCGCAACATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-769s1c1
Sequence:CCGGCGACAACATTGCTCACTTGAACTCGAGTTCAAGTGAGCAATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020698
VALIDATED
TMCC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020698.2-1261s21c1
Sequence:CCGCATCCTGCCAGACTCGCATTTCCTCGAGGAAATGCGAGTCTGGCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020698.2-1837s21c1
Sequence:CCGGTATTGAGACCTTGGCATAATTCTCGAGAATTATGCCAAGGTCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-3938s1c1
Sequence:CCGGGCCTAGCAAATGTGCTTTAATCTCGAGATTAAAGCACATTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020698.1-4339s1c1
Sequence:CCGGCCACTGTTTGTTCTCTTCAATCTCGAGATTGAAGAGAACAAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020698.1-203s1c1
Sequence:CCGGCGTCATGACATGAATACCTTACTCGAGTAAGGTATTCATGTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-386s1c1
Sequence:CCGGGATGGGAATGTTGCGGAGTATCTCGAGATACTCCGCAACATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020698.1-769s1c1
Sequence:CCGGCGACAACATTGCTCACTTGAACTCGAGTTCAAGTGAGCAATGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172051
VALIDATED
TMCC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domain family 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-648s21c1
Sequence:CCGGTGAAGGATGCCCACGTGAAATCTCGAGATTTCACGTGGGCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-599s21c1
Sequence:CCGGAGCTCAAAGGACATCTCTAAACTCGAGTTTAGAGATGTCCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-766s21c1
Sequence:CCGGTGCCAACTTGATCCGGAATAACTCGAGTTATTCCGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-1504s21c1
Sequence:CCGGTGTGACTCTTCTCGCCATATTCTCGAGAATATGGCGAGAAGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172051.2-1697s21c1
Sequence:CCGGAGAGCTACGTGCGGTGTAAATCTCGAGATTTACACCGCACGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172051.2-1085s1c1
Sequence:CCGGGTGCAGTTTAAGAGAGAATATCTCGAGATATTCTCTCTTAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-566s1c1
Sequence:CCGGCTCAGGGAGATCGAACAGAATCTCGAGATTCTGTTCGATCTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172051.2-5251s1c1
Sequence:CCGGCCGTGCTATGTGTTTCAGATACTCGAGTATCTGAAACACATAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-903s1c1
Sequence:CCGGGCAGCGATGACGAATGTTCTACTCGAGTAGAACATTCGTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-1503s1c1
Sequence:CCGGCTGTGACTCTTCTCGCCATATCTCGAGATATGGCGAGAAGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172051
VALIDATED
TMCC3 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domain family 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-648s21c1
Sequence:CCGGTGAAGGATGCCCACGTGAAATCTCGAGATTTCACGTGGGCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-599s21c1
Sequence:CCGGAGCTCAAAGGACATCTCTAAACTCGAGTTTAGAGATGTCCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-766s21c1
Sequence:CCGGTGCCAACTTGATCCGGAATAACTCGAGTTATTCCGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-1504s21c1
Sequence:CCGGTGTGACTCTTCTCGCCATATTCTCGAGAATATGGCGAGAAGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172051.2-1697s21c1
Sequence:CCGGAGAGCTACGTGCGGTGTAAATCTCGAGATTTACACCGCACGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172051.2-1085s1c1
Sequence:CCGGGTGCAGTTTAAGAGAGAATATCTCGAGATATTCTCTCTTAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-566s1c1
Sequence:CCGGCTCAGGGAGATCGAACAGAATCTCGAGATTCTGTTCGATCTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172051.2-5251s1c1
Sequence:CCGGCCGTGCTATGTGTTTCAGATACTCGAGTATCTGAAACACATAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-903s1c1
Sequence:CCGGGCAGCGATGACGAATGTTCTACTCGAGTAGAACATTCGTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-1503s1c1
Sequence:CCGGCTGTGACTCTTCTCGCCATATCTCGAGATATGGCGAGAAGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172051
VALIDATED
TMCC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domain family 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-648s21c1
Sequence:CCGGTGAAGGATGCCCACGTGAAATCTCGAGATTTCACGTGGGCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-599s21c1
Sequence:CCGGAGCTCAAAGGACATCTCTAAACTCGAGTTTAGAGATGTCCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-766s21c1
Sequence:CCGGTGCCAACTTGATCCGGAATAACTCGAGTTATTCCGGATCAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172051.2-1504s21c1
Sequence:CCGGTGTGACTCTTCTCGCCATATTCTCGAGAATATGGCGAGAAGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172051.2-1697s21c1
Sequence:CCGGAGAGCTACGTGCGGTGTAAATCTCGAGATTTACACCGCACGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172051.2-1085s1c1
Sequence:CCGGGTGCAGTTTAAGAGAGAATATCTCGAGATATTCTCTCTTAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-566s1c1
Sequence:CCGGCTCAGGGAGATCGAACAGAATCTCGAGATTCTGTTCGATCTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172051.2-5251s1c1
Sequence:CCGGCCGTGCTATGTGTTTCAGATACTCGAGTATCTGAAACACATAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-903s1c1
Sequence:CCGGGCAGCGATGACGAATGTTCTACTCGAGTAGAACATTCGTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172051.2-1503s1c1
Sequence:CCGGCTGTGACTCTTCTCGCCATATCTCGAGATATGGCGAGAAGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks