EMAIL THIS PAGE TO A FRIEND

TMCO1

transmembrane and coiled-coil domains 1

Synonyms: HP10122 PCIA3 PNAS-136 RP11-466F5.7 TMCC4
UniProtKB ID: Q9UM00, B2REA0, O75545, Q9BZS3, Q9BZU8
Gene ID:
Human(54499) Summary: This locus encodes a transmembrane protein. Mutations at this locus have been associated with craniofacial dysmorphism, skeletal anomalies, and mental retardation. Mutations at this locus have also been associated with open angle glaucoma blindness. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Mouse(68944) transmembrane and coiled-coil domains 1
Rat(289196) transmembrane and coiled-coil domains 1
Zebrafish(378980) transmembrane and coiled-coil domains 1
dog(478992) transmembrane and coiled-coil domains 1
chicken(427100) transmembrane and coiled-coil domains 1
cow(614715) transmembrane and coiled-coil domains 1
sheep(101112778) transmembrane and coiled-coil domains 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49429 Anti-TMCO1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, canine, zebrafish, human, mouse, guinea pig, horse, pig, rat
western blot pricing
HPA054768 Anti-TMCO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019026 Rosetta Predictions human pricing
NM_001009631 Rosetta Predictions rat pricing
NM_001039483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352576 predicted 386
2 SASI_Hs02_00352577 predicted 538
3 SASI_Hs02_00352578 predicted 413
4 SASI_Hs01_00224035 predicted 786
5 SASI_Hs02_00352579 predicted 390
6 SASI_Hs01_00224037 predicted 596
7 SASI_Hs01_00224038 predicted 590
8 SASI_Hs01_00224039 predicted 754
9 SASI_Hs02_00352580 predicted 219
10 SASI_Hs01_00224040 predicted 799
11 SASI_Hs01_00224033 predicted 740
12 SASI_Hs01_00224034 predicted 747
13 SASI_Hs01_00224036 predicted 607
14 SASI_Hs01_00224041 predicted 709
15 SASI_Hs01_00224042 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067490 predicted 195
2 SASI_Rn01_00067491 predicted 746
3 SASI_Rn01_00067492 predicted 675
4 SASI_Rn01_00067493 predicted 751
5 SASI_Rn01_00067494 predicted 731
6 SASI_Rn01_00067495 predicted 292
7 SASI_Rn01_00067496 predicted 727
8 SASI_Rn01_00067497 predicted 788
9 SASI_Rn01_00067498 predicted 624
10 SASI_Rn01_00067499 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098878 predicted 1073
2 SASI_Mm01_00098879 predicted 1221
3 SASI_Mm01_00098880 predicted 943
4 SASI_Mm01_00098881 predicted 849
5 SASI_Mm01_00098882 predicted 940
6 SASI_Mm01_00098883 predicted 950
7 SASI_Mm01_00098884 predicted 837
8 SASI_Mm01_00098885 predicted 828
9 SASI_Mm01_00098886 predicted 1080
10 SASI_Mm01_00098887 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019026
VALIDATED
TMCO1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-526s1c1
Sequence:CCGGCATCGAAATCTGCTGGGAGATCTCGAGATCTCCCAGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-573s1c1
Sequence:CCGGCCTGTATATTCTCTGTACTATCTCGAGATAGTACAGAGAATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-380s1c1
Sequence:CCGGGAGATCTATCAATGGTTCGAACTCGAGTTCGAACCATTGATAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-437s1c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-222s1c1
Sequence:CCGGCCTGGTTTACAGGACAGACAACTCGAGTTGTCTGTCCTGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-606s21c1
Sequence:CCGGTCGATTCGACAGAACATTCAGCTCGAGCTGAATGTTCTGTCGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-448s21c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-935s21c1
Sequence:CCGGATTAGTTAAGTTCAGGTAATGCTCGAGCATTACCTGAACTTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-712s21c1
Sequence:CCGGCTTGAACTCAAGAACTCTTTACTCGAGTAAAGAGTTCTTGAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-323s21c1
Sequence:CCGGAGAGTCAGCTGGTCGACAACACTCGAGTGTTGTCGACCAGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019026
VALIDATED
TMCO1 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-526s1c1
Sequence:CCGGCATCGAAATCTGCTGGGAGATCTCGAGATCTCCCAGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-573s1c1
Sequence:CCGGCCTGTATATTCTCTGTACTATCTCGAGATAGTACAGAGAATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-380s1c1
Sequence:CCGGGAGATCTATCAATGGTTCGAACTCGAGTTCGAACCATTGATAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-437s1c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-222s1c1
Sequence:CCGGCCTGGTTTACAGGACAGACAACTCGAGTTGTCTGTCCTGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-606s21c1
Sequence:CCGGTCGATTCGACAGAACATTCAGCTCGAGCTGAATGTTCTGTCGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-448s21c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-935s21c1
Sequence:CCGGATTAGTTAAGTTCAGGTAATGCTCGAGCATTACCTGAACTTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-712s21c1
Sequence:CCGGCTTGAACTCAAGAACTCTTTACTCGAGTAAAGAGTTCTTGAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-323s21c1
Sequence:CCGGAGAGTCAGCTGGTCGACAACACTCGAGTGTTGTCGACCAGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019026
VALIDATED
TMCO1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-526s1c1
Sequence:CCGGCATCGAAATCTGCTGGGAGATCTCGAGATCTCCCAGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-573s1c1
Sequence:CCGGCCTGTATATTCTCTGTACTATCTCGAGATAGTACAGAGAATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-380s1c1
Sequence:CCGGGAGATCTATCAATGGTTCGAACTCGAGTTCGAACCATTGATAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019026.1-437s1c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019026.1-222s1c1
Sequence:CCGGCCTGGTTTACAGGACAGACAACTCGAGTTGTCTGTCCTGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-606s21c1
Sequence:CCGGTCGATTCGACAGAACATTCAGCTCGAGCTGAATGTTCTGTCGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-448s21c1
Sequence:CCGGCCCTAATGGGAATGTTCAATTCTCGAGAATTGAACATTCCCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-935s21c1
Sequence:CCGGATTAGTTAAGTTCAGGTAATGCTCGAGCATTACCTGAACTTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-712s21c1
Sequence:CCGGCTTGAACTCAAGAACTCTTTACTCGAGTAAAGAGTTCTTGAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019026.3-323s21c1
Sequence:CCGGAGAGTCAGCTGGTCGACAACACTCGAGTGTTGTCGACCAGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026881
TMCO1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000191545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-220s1c1
Sequence:CCGGGACAGACAAATACAAGAGATTCTCGAGAATCTCTTGTATTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-499s1c1
Sequence:CCGGCCAAGGACTATCTCATCGGAACTCGAGTTCCGATGAGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-151s1c1
Sequence:CCGGGCTCATCGTCTTTATCTCCGTCTCGAGACGGAGATAAAGACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026881
TMCO1 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000191545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-220s1c1
Sequence:CCGGGACAGACAAATACAAGAGATTCTCGAGAATCTCTTGTATTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-499s1c1
Sequence:CCGGCCAAGGACTATCTCATCGGAACTCGAGTTCCGATGAGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-151s1c1
Sequence:CCGGGCTCATCGTCTTTATCTCCGTCTCGAGACGGAGATAAAGACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026881
TMCO1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000191545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-220s1c1
Sequence:CCGGGACAGACAAATACAAGAGATTCTCGAGAATCTCTTGTATTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-499s1c1
Sequence:CCGGCCAAGGACTATCTCATCGGAACTCGAGTTCCGATGAGATAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026881.1-151s1c1
Sequence:CCGGGCTCATCGTCTTTATCTCCGTCTCGAGACGGAGATAAAGACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039483
VALIDATED
TMCO1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039483.1-3161s1c1
Sequence:CCGGGGTCTAGATTGACCTAATAAGCTCGAGCTTATTAGGTCAATCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-346s21c1
Sequence:CCGGAGAAGAAGAAGGAAACTATAACTCGAGTTATAGTTTCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-442s21c1
Sequence:CCGGTGTCAATGGTACGGATGAAATCTCGAGATTTCATCCGTACCATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-267s21c1
Sequence:CCGGATAACCTGGGTCCTGGTTTACCTCGAGGTAAACCAGGACCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-618s21c1
Sequence:CCGGTCCTTCATCTTCCTGTATATCCTCGAGGATATACAGGAAGATGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039483.1-3160s21c1
Sequence:CCGGTGGTCTAGATTGACCTAATAACTCGAGTTATTAGGTCAATCTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039483
VALIDATED
TMCO1 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039483.1-3161s1c1
Sequence:CCGGGGTCTAGATTGACCTAATAAGCTCGAGCTTATTAGGTCAATCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-346s21c1
Sequence:CCGGAGAAGAAGAAGGAAACTATAACTCGAGTTATAGTTTCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-442s21c1
Sequence:CCGGTGTCAATGGTACGGATGAAATCTCGAGATTTCATCCGTACCATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-267s21c1
Sequence:CCGGATAACCTGGGTCCTGGTTTACCTCGAGGTAAACCAGGACCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-618s21c1
Sequence:CCGGTCCTTCATCTTCCTGTATATCCTCGAGGATATACAGGAAGATGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039483.1-3160s21c1
Sequence:CCGGTGGTCTAGATTGACCTAATAACTCGAGTTATTAGGTCAATCTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039483
VALIDATED
TMCO1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039483.1-3161s1c1
Sequence:CCGGGGTCTAGATTGACCTAATAAGCTCGAGCTTATTAGGTCAATCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-346s21c1
Sequence:CCGGAGAAGAAGAAGGAAACTATAACTCGAGTTATAGTTTCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-442s21c1
Sequence:CCGGTGTCAATGGTACGGATGAAATCTCGAGATTTCATCCGTACCATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-267s21c1
Sequence:CCGGATAACCTGGGTCCTGGTTTACCTCGAGGTAAACCAGGACCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039483.1-618s21c1
Sequence:CCGGTCCTTCATCTTCCTGTATATCCTCGAGGATATACAGGAAGATGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039483.1-3160s21c1
Sequence:CCGGTGGTCTAGATTGACCTAATAACTCGAGTTATTAGGTCAATCTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks