EMAIL THIS PAGE TO A FRIEND

TMCO2

transmembrane and coiled-coil domains 2

Synonyms: dJ39G22.2
UniProtKB ID: Q7Z6W1
Gene ID:
Mouse(69469) transmembrane and coiled-coil domains 2
Rat(100360795) transmembrane and coiled-coil domains 2
domestic guinea pig(100725256) transmembrane and coiled-coil domains 2
naked mole-rat(101719606) transmembrane and coiled-coil domains 2
cow(768018) transmembrane and coiled-coil domains 2
sheep(101121724) transmembrane and coiled-coil domains 2
domestic cat(101090374) transmembrane and coiled-coil domains 2
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055801 MISSION® esiRNA esiRNA human TMCO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008740 Rosetta Predictions human pricing
NM_001081312 Rosetta Predictions mouse pricing
XM_891146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017624 predicted 203
2 SASI_Hs01_00017625 predicted 202
3 SASI_Hs01_00017626 predicted 391
4 SASI_Hs01_00017627 predicted 307
5 SASI_Hs02_00305553 predicted 386
6 SASI_Hs01_00017628 predicted 299
7 SASI_Hs01_00017629 predicted 203
8 SASI_Hs01_00017630 predicted 305
9 SASI_Hs01_00017631 predicted 296
10 SASI_Hs01_00017632 predicted 365
11 SASI_Hs01_00017633 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297191 predicted 248
2 SASI_Mm02_00297192 predicted 407
3 SASI_Mm02_00297193 predicted 406
4 SASI_Mm02_00297194 predicted 291
5 SASI_Mm02_00297195 predicted 267
6 SASI_Mm02_00297196 predicted 267
7 SASI_Mm02_00297197 predicted 439
8 SASI_Mm02_00297198 predicted 270
9 SASI_Mm02_00297199 predicted 329
10 SASI_Mm02_00297200 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268494 predicted 257
2 SASI_Mm01_00268495 predicted 297
3 SASI_Mm01_00268496 predicted 415
4 SASI_Mm01_00268497 predicted 300
5 SASI_Mm01_00268498 predicted 273
6 SASI_Mm01_00268499 predicted 274
7 SASI_Mm01_00268500 predicted 444
8 SASI_Mm01_00268501 predicted 271
9 SASI_Mm01_00268502 predicted 332
10 SASI_Mm01_00268503 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008740
TMCO2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-121s21c1
Sequence:CCGGGACAACCTCTTAGAGTCTCTCCTCGAGGAGAGACTCTAAGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-457s21c1
Sequence:CCGGTCCTTGGGTCTGCAAGAGAAACTCGAGTTTCTCTTGCAGACCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-515s21c1
Sequence:CCGGAGAACCTAGAAGGGATAATCGCTCGAGCGATTATCCCTTCTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-240s21c1
Sequence:CCGGAGCTGTGCAAATCATCTTGAGCTCGAGCTCAAGATGATTTGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-364s1c1
Sequence:CCGGCTTTACAAGAAGGGCTCACATCTCGAGATGTGAGCCCTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-204s1c1
Sequence:CCGGGCAAACAAGTTTGGGACTATTCTCGAGAATAGTCCCAAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-346s1c1
Sequence:CCGGGTAATCACACTCTACAAACTTCTCGAGAAGTTTGTAGAGTGTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-306s1c1
Sequence:CCGGGAAACGAAGTATTCAGTCAATCTCGAGATTGACTGAATACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008740
TMCO2 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-121s21c1
Sequence:CCGGGACAACCTCTTAGAGTCTCTCCTCGAGGAGAGACTCTAAGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-457s21c1
Sequence:CCGGTCCTTGGGTCTGCAAGAGAAACTCGAGTTTCTCTTGCAGACCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-515s21c1
Sequence:CCGGAGAACCTAGAAGGGATAATCGCTCGAGCGATTATCCCTTCTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-240s21c1
Sequence:CCGGAGCTGTGCAAATCATCTTGAGCTCGAGCTCAAGATGATTTGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-364s1c1
Sequence:CCGGCTTTACAAGAAGGGCTCACATCTCGAGATGTGAGCCCTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-204s1c1
Sequence:CCGGGCAAACAAGTTTGGGACTATTCTCGAGAATAGTCCCAAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-346s1c1
Sequence:CCGGGTAATCACACTCTACAAACTTCTCGAGAAGTTTGTAGAGTGTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-306s1c1
Sequence:CCGGGAAACGAAGTATTCAGTCAATCTCGAGATTGACTGAATACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008740
TMCO2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-121s21c1
Sequence:CCGGGACAACCTCTTAGAGTCTCTCCTCGAGGAGAGACTCTAAGAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-457s21c1
Sequence:CCGGTCCTTGGGTCTGCAAGAGAAACTCGAGTTTCTCTTGCAGACCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-515s21c1
Sequence:CCGGAGAACCTAGAAGGGATAATCGCTCGAGCGATTATCCCTTCTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008740.3-240s21c1
Sequence:CCGGAGCTGTGCAAATCATCTTGAGCTCGAGCTCAAGATGATTTGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-364s1c1
Sequence:CCGGCTTTACAAGAAGGGCTCACATCTCGAGATGTGAGCCCTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-204s1c1
Sequence:CCGGGCAAACAAGTTTGGGACTATTCTCGAGAATAGTCCCAAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-346s1c1
Sequence:CCGGGTAATCACACTCTACAAACTTCTCGAGAAGTTTGTAGAGTGTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008740.2-306s1c1
Sequence:CCGGGAAACGAAGTATTCAGTCAATCTCGAGATTGACTGAATACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081312
TMCO2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-263s21c1
Sequence:CCGGTGTTGGCAATTGGACTATTTGCTCGAGCAAATAGTCCAATTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-97s21c1
Sequence:CCGGTCTTGGGACAACCTCTTAAATCTCGAGATTTAAGAGGTTGTCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-333s21c1
Sequence:CCGGGATCACACTCTACCAACTTTACTCGAGTAAAGTTGGTAGAGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-143s21c1
Sequence:CCGGATTGGTTACAAGCAATGTTTACTCGAGTAAACATTGCTTGTAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-409s21c1
Sequence:CCGGCGCCAGATTCAAGACAATAATCTCGAGATTATTGTCTTGAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081312
TMCO2 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-263s21c1
Sequence:CCGGTGTTGGCAATTGGACTATTTGCTCGAGCAAATAGTCCAATTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-97s21c1
Sequence:CCGGTCTTGGGACAACCTCTTAAATCTCGAGATTTAAGAGGTTGTCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-333s21c1
Sequence:CCGGGATCACACTCTACCAACTTTACTCGAGTAAAGTTGGTAGAGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-143s21c1
Sequence:CCGGATTGGTTACAAGCAATGTTTACTCGAGTAAACATTGCTTGTAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-409s21c1
Sequence:CCGGCGCCAGATTCAAGACAATAATCTCGAGATTATTGTCTTGAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081312
TMCO2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-263s21c1
Sequence:CCGGTGTTGGCAATTGGACTATTTGCTCGAGCAAATAGTCCAATTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-97s21c1
Sequence:CCGGTCTTGGGACAACCTCTTAAATCTCGAGATTTAAGAGGTTGTCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-333s21c1
Sequence:CCGGGATCACACTCTACCAACTTTACTCGAGTAAAGTTGGTAGAGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-143s21c1
Sequence:CCGGATTGGTTACAAGCAATGTTTACTCGAGTAAACATTGCTTGTAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081312.1-409s21c1
Sequence:CCGGCGCCAGATTCAAGACAATAATCTCGAGATTATTGTCTTGAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks