EMAIL THIS PAGE TO A FRIEND

TMCO3

transmembrane and coiled-coil domains 3

Synonyms: C13orf11
Gene ID:
Mouse(234076) transmembrane and coiled-coil domains 3
Rat(306607) transmembrane and coiled-coil domains 3
Zebrafish(564309) transmembrane and coiled-coil domains 3
chicken(395675) transmembrane and coiled-coil domains 3
dog(485556) transmembrane and coiled-coil domains 3
domestic cat(101091587) transmembrane and coiled-coil domains 3
cow(509611) transmembrane and coiled-coil domains 3
sheep(101117256) transmembrane and coiled-coil domains 3
naked mole-rat(101698300) transmembrane and coiled-coil domains 3
domestic guinea pig(100732784) transmembrane and coiled-coil domains 3
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017905 Rosetta Predictions human pricing
XM_001075325 Rosetta Predictions rat pricing
XM_225016 Rosetta Predictions rat pricing
NM_172282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075034 predicted 1016
2 SASI_Hs01_00075035 predicted 899
3 SASI_Hs02_00350878 predicted 1384
4 SASI_Hs01_00075036 predicted 1428
5 SASI_Hs01_00075037 predicted 1089
6 SASI_Hs01_00075038 predicted 887
7 SASI_Hs01_00075039 predicted 623
8 SASI_Hs01_00075040 predicted 1284
9 SASI_Hs01_00075041 predicted 627
10 SASI_Hs01_00075042 predicted 1296
11 SASI_Hs01_00075043 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349340 predicted 1199
2 SASI_Rn02_00349341 predicted 1116
3 SASI_Rn02_00349342 predicted 1595
4 SASI_Rn02_00349343 predicted 853
5 SASI_Rn02_00349344 predicted 696
6 SASI_Rn02_00349345 predicted 1165
7 SASI_Rn02_00349346 predicted 682
8 SASI_Rn02_00349347 predicted 1584
9 SASI_Rn02_00349348 predicted 414
10 SASI_Rn02_00349349 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382447 predicted 1199
2 SASI_Rn02_00382448 predicted 1112
3 SASI_Rn02_00382449 predicted 1599
4 SASI_Rn02_00382450 predicted 855
5 SASI_Rn02_00382451 predicted 691
6 SASI_Rn02_00382452 predicted 1161
7 SASI_Rn02_00382453 predicted 683
8 SASI_Rn02_00382454 predicted 1579
9 SASI_Rn02_00382455 predicted 417
10 SASI_Rn02_00382456 predicted 1913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038032 predicted 1813
2 SASI_Mm01_00038033 predicted 1885
3 SASI_Mm01_00038034 predicted 1493
4 SASI_Mm01_00038035 predicted 1216
5 SASI_Mm01_00038037 predicted 1067
6 SASI_Mm01_00038038 predicted 1891
7 SASI_Mm01_00038039 predicted 1329
8 SASI_Mm01_00038040 predicted 1375
9 SASI_Mm01_00038041 predicted 1525
10 SASI_Mm02_00343769 predicted 2100
11 SASI_Mm01_00038036 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172282
TMCO3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-229s1c1
Sequence:CCGGCTTCCCTTCTTTCACCTGATACTCGAGTATCAGGTGAAAGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1071s1c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2410s1c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1631s1c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-802s1c1
Sequence:CCGGGACGACAATAAATCAGTCAAACTCGAGTTTGACTGATTTATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2358s1c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1325s21c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1885s21c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2664s21c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2612s21c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172282
TMCO3 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-229s1c1
Sequence:CCGGCTTCCCTTCTTTCACCTGATACTCGAGTATCAGGTGAAAGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1071s1c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2410s1c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1631s1c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-802s1c1
Sequence:CCGGGACGACAATAAATCAGTCAAACTCGAGTTTGACTGATTTATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2358s1c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1325s21c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1885s21c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2664s21c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2612s21c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172282
TMCO3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-229s1c1
Sequence:CCGGCTTCCCTTCTTTCACCTGATACTCGAGTATCAGGTGAAAGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1071s1c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2410s1c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172282.1-1631s1c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172282.1-802s1c1
Sequence:CCGGGACGACAATAAATCAGTCAAACTCGAGTTTGACTGATTTATTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172282.1-2358s1c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1325s21c1
Sequence:CCGGGCCTACGATGTTTGGGTATATCTCGAGATATACCCAAACATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172282.2-1885s21c1
Sequence:CCGGCGTATCTCATAGGACCGTATTCTCGAGAATACGGTCCTATGAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2664s21c1
Sequence:CCGGCCAGAGTAATTTATTTGCAGTCTCGAGACTGCAAATAAATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172282.2-2612s21c1
Sequence:CCGGCCTCATGCTTGCTTGCTATTTCTCGAGAAATAGCAAGCAAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017905
VALIDATED
TMCO3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-1234s1c1
Sequence:CCGGGATTGCCTACAATGTTTGGTTCTCGAGAACCAAACATTGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-555s1c1
Sequence:CCGGGCAGTTCTGAACAAACTGAAACTCGAGTTTCAGTTTGTTCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1317s1c1
Sequence:CCGGGTGGAGACATTAGGAGAATTTCTCGAGAAATTCTCCTAATGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2594s1c1
Sequence:CCGGGTCTGTTGATTATGTGCAGTACTCGAGTACTGCACATAATCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1026s1c1
Sequence:CCGGGAAGAGGCCAATTCTAAGCAACTCGAGTTGCTTAGAATTGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1686s1c1
Sequence:CCGGGCCAGTGCATCTTCTAGCATTCTCGAGAATGCTAGAAGATGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2848s1c1
Sequence:CCGGCGTGAGCTTGGAAGCTTACTTCTCGAGAAGTAAGCTTCCAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017905.3-2575s1c1
Sequence:CCGGCCGGAGTAGTTTATTTGCAGTCTCGAGACTGCAAATAAACTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1076s1c1
Sequence:CCGGCTTGGGTCTTAGCATGCTGATCTCGAGATCAGCATGCTAAGACCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-915s1c1
Sequence:CCGGGATGTAAGAAAGGCAGCGGATCTCGAGATCCGCTGCCTTTCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2899s1c1
Sequence:CCGGGAGACAAATACGGATGTCTATCTCGAGATAGACATCCGTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017905
VALIDATED
TMCO3 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-1234s1c1
Sequence:CCGGGATTGCCTACAATGTTTGGTTCTCGAGAACCAAACATTGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-555s1c1
Sequence:CCGGGCAGTTCTGAACAAACTGAAACTCGAGTTTCAGTTTGTTCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1317s1c1
Sequence:CCGGGTGGAGACATTAGGAGAATTTCTCGAGAAATTCTCCTAATGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2594s1c1
Sequence:CCGGGTCTGTTGATTATGTGCAGTACTCGAGTACTGCACATAATCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1026s1c1
Sequence:CCGGGAAGAGGCCAATTCTAAGCAACTCGAGTTGCTTAGAATTGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1686s1c1
Sequence:CCGGGCCAGTGCATCTTCTAGCATTCTCGAGAATGCTAGAAGATGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2848s1c1
Sequence:CCGGCGTGAGCTTGGAAGCTTACTTCTCGAGAAGTAAGCTTCCAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017905.3-2575s1c1
Sequence:CCGGCCGGAGTAGTTTATTTGCAGTCTCGAGACTGCAAATAAACTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1076s1c1
Sequence:CCGGCTTGGGTCTTAGCATGCTGATCTCGAGATCAGCATGCTAAGACCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-915s1c1
Sequence:CCGGGATGTAAGAAAGGCAGCGGATCTCGAGATCCGCTGCCTTTCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2899s1c1
Sequence:CCGGGAGACAAATACGGATGTCTATCTCGAGATAGACATCCGTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017905
VALIDATED
TMCO3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-1234s1c1
Sequence:CCGGGATTGCCTACAATGTTTGGTTCTCGAGAACCAAACATTGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-555s1c1
Sequence:CCGGGCAGTTCTGAACAAACTGAAACTCGAGTTTCAGTTTGTTCAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1317s1c1
Sequence:CCGGGTGGAGACATTAGGAGAATTTCTCGAGAAATTCTCCTAATGTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2594s1c1
Sequence:CCGGGTCTGTTGATTATGTGCAGTACTCGAGTACTGCACATAATCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1026s1c1
Sequence:CCGGGAAGAGGCCAATTCTAAGCAACTCGAGTTGCTTAGAATTGGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017905.3-1686s1c1
Sequence:CCGGGCCAGTGCATCTTCTAGCATTCTCGAGAATGCTAGAAGATGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2848s1c1
Sequence:CCGGCGTGAGCTTGGAAGCTTACTTCTCGAGAAGTAAGCTTCCAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017905.3-2575s1c1
Sequence:CCGGCCGGAGTAGTTTATTTGCAGTCTCGAGACTGCAAATAAACTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017905.3-1076s1c1
Sequence:CCGGCTTGGGTCTTAGCATGCTGATCTCGAGATCAGCATGCTAAGACCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017905.3-915s1c1
Sequence:CCGGGATGTAAGAAAGGCAGCGGATCTCGAGATCCGCTGCCTTTCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017905.3-2899s1c1
Sequence:CCGGGAGACAAATACGGATGTCTATCTCGAGATAGACATCCGTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks