EMAIL THIS PAGE TO A FRIEND

TMCO4

transmembrane and coiled-coil domains 4

Synonyms: RP5-1056L3.6
UniProtKB ID: Q5TGY1, Q5TGY2, Q6MZN5, Q7Z6K6, Q9UQP4, Q9Y3K1
Gene ID:
Mouse(77056) transmembrane and coiled-coil domains 4
Rat(500573) transmembrane and coiled-coil domains 4
domestic guinea pig(100722998) transmembrane and coiled-coil domains 4
naked mole-rat(101709160) transmembrane and coiled-coil domains 4
cow(512168) transmembrane and coiled-coil domains 4
sheep(101107935) transmembrane and coiled-coil domains 4
Zebrafish(449956) transmembrane and coiled-coil domains 4
Horse(100071888) transmembrane and coiled-coil domains 4
domestic cat(101091127) transmembrane and coiled-coil domains 4
dog(487401) transmembrane and coiled-coil domains 4
chicken(419476) transmembrane and coiled-coil domains 4
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181719 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181719 Rosetta Predictions human pricing
NM_001034949 Rosetta Predictions rat pricing
NM_029857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066127 predicted 2179
2 SASI_Hs01_00066128 predicted 388
3 SASI_Hs01_00066129 predicted 1256
4 SASI_Hs01_00066130 predicted 623
5 SASI_Hs01_00066131 predicted 413
6 SASI_Hs01_00066132 predicted 1505
7 SASI_Hs01_00066133 predicted 792
8 SASI_Hs01_00066134 predicted 608
9 SASI_Hs01_00066135 predicted 1933
10 SASI_Hs01_00066136 predicted 2191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056345 predicted 930
2 SASI_Rn01_00056346 predicted 2159
3 SASI_Rn02_00204136 predicted 1569
4 SASI_Rn02_00204137 predicted 1885
5 SASI_Rn01_00056348 predicted 502
6 SASI_Rn01_00056349 predicted 1004
7 SASI_Rn02_00204138 predicted 394
8 SASI_Rn02_00204139 predicted 438
9 SASI_Rn01_00056351 predicted 790
10 SASI_Rn01_00056352 predicted 1052
11 SASI_Rn01_00056344 predicted 1625
12 SASI_Rn01_00056347 predicted 1888
13 SASI_Rn01_00056350 predicted 1093
14 SASI_Rn01_00056353 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118162 predicted 1473
2 SASI_Mm01_00118164 predicted 1325
3 SASI_Mm02_00336078 predicted 2687
4 SASI_Mm02_00336079 predicted 1538
5 SASI_Mm01_00118165 predicted 1144
6 SASI_Mm01_00118166 predicted 2112
7 SASI_Mm01_00118167 predicted 928
8 SASI_Mm01_00118168 predicted 2700
9 SASI_Mm01_00118169 predicted 1125
10 SASI_Mm01_00118171 predicted 2413
11 SASI_Mm01_00118163 predicted 2102
12 SASI_Mm01_00118170 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029857
TMCO4 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029857.3-3049s21c1
Sequence:CCGGAGGTGCCAATGAGACACTTTGCTCGAGCAAAGTGTCTCATTGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029857.3-1133s21c1
Sequence:CCGGCACTCAAGAATGGACACTATGCTCGAGCATAGTGTCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1049s1c1
Sequence:CCGGCCGACATCTTTGCTCAGACTTCTCGAGAAGTCTGAGCAAAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1474s1c1
Sequence:CCGGGCTGTTATGACTTCACTGTTTCTCGAGAAACAGTGAAGTCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1629s1c1
Sequence:CCGGCGGCAGATACCGCACATTTAACTCGAGTTAAATGTGCGGTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1590s1c1
Sequence:CCGGGCTACATATCACCATTGCCATCTCGAGATGGCAATGGTGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029857.2-2693s1c1
Sequence:CCGGCCAGACTTCTGTATGCAACTTCTCGAGAAGTTGCATACAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029857
TMCO4 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029857.3-3049s21c1
Sequence:CCGGAGGTGCCAATGAGACACTTTGCTCGAGCAAAGTGTCTCATTGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029857.3-1133s21c1
Sequence:CCGGCACTCAAGAATGGACACTATGCTCGAGCATAGTGTCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1049s1c1
Sequence:CCGGCCGACATCTTTGCTCAGACTTCTCGAGAAGTCTGAGCAAAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1474s1c1
Sequence:CCGGGCTGTTATGACTTCACTGTTTCTCGAGAAACAGTGAAGTCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1629s1c1
Sequence:CCGGCGGCAGATACCGCACATTTAACTCGAGTTAAATGTGCGGTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1590s1c1
Sequence:CCGGGCTACATATCACCATTGCCATCTCGAGATGGCAATGGTGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029857.2-2693s1c1
Sequence:CCGGCCAGACTTCTGTATGCAACTTCTCGAGAAGTTGCATACAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029857
TMCO4 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029857.3-3049s21c1
Sequence:CCGGAGGTGCCAATGAGACACTTTGCTCGAGCAAAGTGTCTCATTGGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029857.3-1133s21c1
Sequence:CCGGCACTCAAGAATGGACACTATGCTCGAGCATAGTGTCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1049s1c1
Sequence:CCGGCCGACATCTTTGCTCAGACTTCTCGAGAAGTCTGAGCAAAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1474s1c1
Sequence:CCGGGCTGTTATGACTTCACTGTTTCTCGAGAAACAGTGAAGTCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1629s1c1
Sequence:CCGGCGGCAGATACCGCACATTTAACTCGAGTTAAATGTGCGGTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029857.2-1590s1c1
Sequence:CCGGGCTACATATCACCATTGCCATCTCGAGATGGCAATGGTGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029857.2-2693s1c1
Sequence:CCGGCCAGACTTCTGTATGCAACTTCTCGAGAAGTTGCATACAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181719
TMCO4 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-792s21c1
Sequence:CCGGCGGAGGAAATGGAAGCGTTATCTCGAGATAACGCTTCCATTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-384s21c1
Sequence:CCGGATCTCCCTGTCCCAGTTATTTCTCGAGAAATAACTGGGACAGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-1027s1c1
Sequence:CCGGGCCATTGAAGAGTTCACGTTTCTCGAGAAACGTGAACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181719.2-2405s1c1
Sequence:CCGGGAGTCAACCAAGCACAGGTTACTCGAGTAACCTGTGCTTGGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-769s1c1
Sequence:CCGGGCATCCCGAAAGAAGAAAGAACTCGAGTTCTTTCTTCTTTCGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-993s1c1
Sequence:CCGGCCTGACAGGATACAAGATGAACTCGAGTTCATCTTGTATCCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-423s1c1
Sequence:CCGGCTCCTTCTGCACAGAGTTCATCTCGAGATGAACTCTGTGCAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2811s1c1
Sequence:CCGGGCATGGTGAATACATGCTGAACTCGAGTTCAGCATGTATTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-1462s1c1
Sequence:CCGGGCCAGAGTCATCTACTTCTGTCTCGAGACAGAAGTAGATGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2260s1c1
Sequence:CCGGCCTAAATGGAAGGAATTGGAACTCGAGTTCCAATTCCTTCCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181719
TMCO4 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-792s21c1
Sequence:CCGGCGGAGGAAATGGAAGCGTTATCTCGAGATAACGCTTCCATTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-384s21c1
Sequence:CCGGATCTCCCTGTCCCAGTTATTTCTCGAGAAATAACTGGGACAGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-1027s1c1
Sequence:CCGGGCCATTGAAGAGTTCACGTTTCTCGAGAAACGTGAACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181719.2-2405s1c1
Sequence:CCGGGAGTCAACCAAGCACAGGTTACTCGAGTAACCTGTGCTTGGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-769s1c1
Sequence:CCGGGCATCCCGAAAGAAGAAAGAACTCGAGTTCTTTCTTCTTTCGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-993s1c1
Sequence:CCGGCCTGACAGGATACAAGATGAACTCGAGTTCATCTTGTATCCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-423s1c1
Sequence:CCGGCTCCTTCTGCACAGAGTTCATCTCGAGATGAACTCTGTGCAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2811s1c1
Sequence:CCGGGCATGGTGAATACATGCTGAACTCGAGTTCAGCATGTATTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-1462s1c1
Sequence:CCGGGCCAGAGTCATCTACTTCTGTCTCGAGACAGAAGTAGATGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2260s1c1
Sequence:CCGGCCTAAATGGAAGGAATTGGAACTCGAGTTCCAATTCCTTCCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181719
TMCO4 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-792s21c1
Sequence:CCGGCGGAGGAAATGGAAGCGTTATCTCGAGATAACGCTTCCATTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181719.4-384s21c1
Sequence:CCGGATCTCCCTGTCCCAGTTATTTCTCGAGAAATAACTGGGACAGGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-1027s1c1
Sequence:CCGGGCCATTGAAGAGTTCACGTTTCTCGAGAAACGTGAACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181719.2-2405s1c1
Sequence:CCGGGAGTCAACCAAGCACAGGTTACTCGAGTAACCTGTGCTTGGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-769s1c1
Sequence:CCGGGCATCCCGAAAGAAGAAAGAACTCGAGTTCTTTCTTCTTTCGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-993s1c1
Sequence:CCGGCCTGACAGGATACAAGATGAACTCGAGTTCATCTTGTATCCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181719.2-423s1c1
Sequence:CCGGCTCCTTCTGCACAGAGTTCATCTCGAGATGAACTCTGTGCAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2811s1c1
Sequence:CCGGGCATGGTGAATACATGCTGAACTCGAGTTCAGCATGTATTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181719.2-1462s1c1
Sequence:CCGGGCCAGAGTCATCTACTTCTGTCTCGAGACAGAAGTAGATGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181719.2-2260s1c1
Sequence:CCGGCCTAAATGGAAGGAATTGGAACTCGAGTTCCAATTCCTTCCATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks