EMAIL THIS PAGE TO A FRIEND

TMCO5A

transmembrane and coiled-coil domains 5A

Synonyms: TMCO5
UniProtKB ID: Q8N6Q1, Q8NA63
Gene ID:
Rat(499865) transmembrane and coiled-coil domains 5A
cow(617536) transmembrane and coiled-coil domains 5A
sheep(101112065) transmembrane and coiled-coil domains 5A
naked mole-rat(101711486) transmembrane and coiled-coil domains 5A
domestic guinea pig(100734374) transmembrane and coiled-coil domains 5A
dog(478253) transmembrane and coiled-coil domains 5A
domestic cat(101089194) transmembrane and coiled-coil domains 5A
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089541 MISSION® esiRNA esiRNA human TMCO5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152453 Rosetta Predictions human pricing
XM_575207 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212336 predicted 461
2 SASI_Hs01_00212337 predicted 413
3 SASI_Hs01_00212338 predicted 742
4 SASI_Hs01_00212339 predicted 469
5 SASI_Hs01_00212340 predicted 847
6 SASI_Hs01_00212341 predicted 469
7 SASI_Hs01_00212342 predicted 544
8 SASI_Hs01_00212343 predicted 468
9 SASI_Hs01_00212344 predicted 585
10 SASI_Hs01_00212345 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403267 predicted 635
2 SASI_Rn02_00403268 predicted 1002
3 SASI_Rn02_00403269 predicted 1136
4 SASI_Rn02_00403270 predicted 707
5 SASI_Rn02_00403271 predicted 620
6 SASI_Rn02_00403272 predicted 904
7 SASI_Rn02_00403273 predicted 1050
8 SASI_Rn02_00403274 predicted 839
9 SASI_Rn02_00403275 predicted 872
10 SASI_Rn02_00403276 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152453
TMCO5A MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 5A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-439s21c1
Sequence:CCGGGATAACCAATTGTGAACAAAGCTCGAGCTTTGTTCACAATTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-586s21c1
Sequence:CCGGAGATCAAGCCCTCTACATAAACTCGAGTTTATGTAGAGGGCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-609s21c1
Sequence:CCGGAGTACCAGGAAACGTTGAAGACTCGAGTCTTCAACGTTTCCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152453.2-992s1c1
Sequence:CCGGGCAATAGAAGGGAAGTGGGATCTCGAGATCCCACTTCCCTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-185s1c1
Sequence:CCGGGATGAAGCAAACCAGAAACTTCTCGAGAAGTTTCTGGTTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-360s1c1
Sequence:CCGGCCAGACTTGAAAGGAAGAATACTCGAGTATTCTTCCTTTCAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152453.2-974s1c1
Sequence:CCGGCCTAAGAAATATCCTTGAGCACTCGAGTGCTCAAGGATATTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-542s1c1
Sequence:CCGGCTCAAGGTAATGAAGGAGTATCTCGAGATACTCCTTCATTACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-241s1c1
Sequence:CCGGGAGGCTGGAAAGTGAGATCATCTCGAGATGATCTCACTTTCCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-174s1c1
Sequence:CCGGCGCAGAGAATAGATGAAGCAACTCGAGTTGCTTCATCTATTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-854s1c1
Sequence:CCGGCCAGATCTCCTCGTCAATGTACTCGAGTACATTGACGAGGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152453
TMCO5A MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 5A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-439s21c1
Sequence:CCGGGATAACCAATTGTGAACAAAGCTCGAGCTTTGTTCACAATTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-586s21c1
Sequence:CCGGAGATCAAGCCCTCTACATAAACTCGAGTTTATGTAGAGGGCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-609s21c1
Sequence:CCGGAGTACCAGGAAACGTTGAAGACTCGAGTCTTCAACGTTTCCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152453.2-992s1c1
Sequence:CCGGGCAATAGAAGGGAAGTGGGATCTCGAGATCCCACTTCCCTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-185s1c1
Sequence:CCGGGATGAAGCAAACCAGAAACTTCTCGAGAAGTTTCTGGTTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-360s1c1
Sequence:CCGGCCAGACTTGAAAGGAAGAATACTCGAGTATTCTTCCTTTCAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152453.2-974s1c1
Sequence:CCGGCCTAAGAAATATCCTTGAGCACTCGAGTGCTCAAGGATATTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-542s1c1
Sequence:CCGGCTCAAGGTAATGAAGGAGTATCTCGAGATACTCCTTCATTACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-241s1c1
Sequence:CCGGGAGGCTGGAAAGTGAGATCATCTCGAGATGATCTCACTTTCCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-174s1c1
Sequence:CCGGCGCAGAGAATAGATGAAGCAACTCGAGTTGCTTCATCTATTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-854s1c1
Sequence:CCGGCCAGATCTCCTCGTCAATGTACTCGAGTACATTGACGAGGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152453
TMCO5A MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 5A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-439s21c1
Sequence:CCGGGATAACCAATTGTGAACAAAGCTCGAGCTTTGTTCACAATTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-586s21c1
Sequence:CCGGAGATCAAGCCCTCTACATAAACTCGAGTTTATGTAGAGGGCTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152453.2-609s21c1
Sequence:CCGGAGTACCAGGAAACGTTGAAGACTCGAGTCTTCAACGTTTCCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152453.2-992s1c1
Sequence:CCGGGCAATAGAAGGGAAGTGGGATCTCGAGATCCCACTTCCCTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-185s1c1
Sequence:CCGGGATGAAGCAAACCAGAAACTTCTCGAGAAGTTTCTGGTTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-360s1c1
Sequence:CCGGCCAGACTTGAAAGGAAGAATACTCGAGTATTCTTCCTTTCAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152453.2-974s1c1
Sequence:CCGGCCTAAGAAATATCCTTGAGCACTCGAGTGCTCAAGGATATTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-542s1c1
Sequence:CCGGCTCAAGGTAATGAAGGAGTATCTCGAGATACTCCTTCATTACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-241s1c1
Sequence:CCGGGAGGCTGGAAAGTGAGATCATCTCGAGATGATCTCACTTTCCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152453.2-174s1c1
Sequence:CCGGCGCAGAGAATAGATGAAGCAACTCGAGTTGCTTCATCTATTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152453.2-854s1c1
Sequence:CCGGCCAGATCTCCTCGTCAATGTACTCGAGTACATTGACGAGGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks