EMAIL THIS PAGE TO A FRIEND

TMCO5B

transmembrane and coiled-coil domains 5B, pseudogene

UniProtKB ID: A8MYB1
Gene ID:
Mouse(75275) transmembrane and coiled-coil domains 5B
Rat(366158) transmembrane and coiled-coil domains 5B
cow(513290) transmembrane and coiled-coil domains 5B
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001080546 Rosetta Predictions rat pricing
XM_575205 Rosetta Predictions rat pricing
NM_029232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368363 predicted 599
2 SASI_Rn02_00368364 predicted 446
3 SASI_Rn02_00368365 predicted 486
4 SASI_Rn02_00368366 predicted 991
5 SASI_Rn02_00368367 predicted 974
6 SASI_Rn02_00368368 predicted 788
7 SASI_Rn02_00368369 predicted 317
8 SASI_Rn02_00368370 predicted 734
9 SASI_Rn02_00368371 predicted 625
10 SASI_Rn02_00368372 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403247 predicted 472
2 SASI_Rn02_00403248 predicted 322
3 SASI_Rn02_00403249 predicted 361
4 SASI_Rn02_00403250 predicted 868
5 SASI_Rn02_00403251 predicted 848
6 SASI_Rn02_00403252 predicted 660
7 SASI_Rn02_00403253 predicted 609
8 SASI_Rn02_00403254 predicted 461
9 SASI_Rn02_00403255 predicted 496
10 SASI_Rn02_00403256 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060954 predicted 605
2 SASI_Mm01_00060955 predicted 703
3 SASI_Mm01_00060956 predicted 449
4 SASI_Mm01_00060957 predicted 538
5 SASI_Mm01_00060958 predicted 319
6 SASI_Mm01_00060959 predicted 744
7 SASI_Mm01_00060960 predicted 757
8 SASI_Mm01_00060961 predicted 985
9 SASI_Mm01_00060962 predicted 381
10 SASI_Mm01_00060963 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029232
TMCO5B MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 5B, pseudogene
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-265s1c1
Sequence:CCGGGCCAATCAGATTCTCCTCAGACTCGAGTCTGAGGAGAATCTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-927s1c1
Sequence:CCGGGCAATATGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-678s1c1
Sequence:CCGGCCAAGAAATTCTGAGGGAGATCTCGAGATCTCCCTCAGAATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-271s1c1
Sequence:CCGGCAGATTCTCCTCAGAAAGATTCTCGAGAATCTTTCTGAGGAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-170s1c1
Sequence:CCGGCTGAGATTACAGAAATACCAACTCGAGTTGGTATTTCTGTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-980s1c1
Sequence:CCGGGAAGTAGCTTGAAGTGGCTAACTCGAGTTAGCCACTTCAAGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-454s1c1
Sequence:CCGGCTAAGCAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029232
TMCO5B MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 5B, pseudogene
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-265s1c1
Sequence:CCGGGCCAATCAGATTCTCCTCAGACTCGAGTCTGAGGAGAATCTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-927s1c1
Sequence:CCGGGCAATATGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-678s1c1
Sequence:CCGGCCAAGAAATTCTGAGGGAGATCTCGAGATCTCCCTCAGAATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-271s1c1
Sequence:CCGGCAGATTCTCCTCAGAAAGATTCTCGAGAATCTTTCTGAGGAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-170s1c1
Sequence:CCGGCTGAGATTACAGAAATACCAACTCGAGTTGGTATTTCTGTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-980s1c1
Sequence:CCGGGAAGTAGCTTGAAGTGGCTAACTCGAGTTAGCCACTTCAAGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-454s1c1
Sequence:CCGGCTAAGCAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029232
TMCO5B MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 5B, pseudogene
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-265s1c1
Sequence:CCGGGCCAATCAGATTCTCCTCAGACTCGAGTCTGAGGAGAATCTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-927s1c1
Sequence:CCGGGCAATATGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-678s1c1
Sequence:CCGGCCAAGAAATTCTGAGGGAGATCTCGAGATCTCCCTCAGAATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-271s1c1
Sequence:CCGGCAGATTCTCCTCAGAAAGATTCTCGAGAATCTTTCTGAGGAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-170s1c1
Sequence:CCGGCTGAGATTACAGAAATACCAACTCGAGTTGGTATTTCTGTAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029232.1-980s1c1
Sequence:CCGGGAAGTAGCTTGAAGTGGCTAACTCGAGTTAGCCACTTCAAGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029232.1-454s1c1
Sequence:CCGGCTAAGCAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks