EMAIL THIS PAGE TO A FRIEND

TMCO6

transmembrane and coiled-coil domains 6

UniProtKB ID: Q96DC7, Q9BUU0, Q9P198
Gene ID:
Mouse(71983) transmembrane and coiled-coil domains 6
Rat(291661) transmembrane and coiled-coil domains 6
cow(100138035) transmembrane and coiled-coil domains 6
sheep(101119722) transmembrane and coiled-coil domains 6
domestic guinea pig(100735586) transmembrane and coiled-coil domains 6
naked mole-rat(101709802) transmembrane and coiled-coil domains 6
chicken(416135) transmembrane and coiled-coil domains 6
dog(487163) transmembrane and coiled-coil domains 6
domestic cat(101091993) transmembrane and coiled-coil domains 6
Horse(100061843) transmembrane and coiled-coil domains 6
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018502 Rosetta Predictions human pricing
NM_001106154 Rosetta Predictions rat pricing
NM_028036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028427 predicted 1638
2 SASI_Hs01_00028428 predicted 1102
3 SASI_Hs01_00028429 predicted 1420
4 SASI_Hs01_00028430 predicted 601
5 SASI_Hs01_00028431 predicted 1536
6 SASI_Hs01_00028432 predicted 1606
7 SASI_Hs01_00028433 predicted 1211
8 SASI_Hs01_00028434 predicted 1298
9 SASI_Hs01_00028435 predicted 381
10 SASI_Hs01_00028436 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216158 predicted 1559
2 SASI_Rn02_00216159 predicted 807
3 SASI_Rn02_00216160 predicted 1138
4 SASI_Rn02_00216161 predicted 581
5 SASI_Rn02_00216162 predicted 1074
6 SASI_Rn02_00216163 predicted 1615
7 SASI_Rn02_00216164 predicted 1383
8 SASI_Rn02_00216165 predicted 1262
9 SASI_Rn02_00216166 predicted 1571
10 SASI_Rn02_00216167 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333188 predicted 790
2 SASI_Mm02_00333189 predicted 1264
3 SASI_Mm02_00333190 predicted 984
4 SASI_Mm01_00184486 predicted 1104
5 SASI_Mm01_00184488 predicted 1285
6 SASI_Mm02_00333191 predicted 771
7 SASI_Mm01_00184492 predicted 1543
8 SASI_Mm01_00184493 predicted 1146
9 SASI_Mm02_00333192 predicted 1339
10 SASI_Mm02_00333193 predicted 1308
11 SASI_Mm01_00184485 predicted 1206
12 SASI_Mm01_00184487 predicted 886
13 SASI_Mm01_00184489 predicted 1037
14 SASI_Mm01_00184490 predicted 1454
15 SASI_Mm01_00184491 predicted 1272
16 SASI_Mm01_00184494 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018502
VALIDATED
TMCO6 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1219s1c1
Sequence:CCGGGTATCTAACGTGGTGAGCGTACTCGAGTACGCTCACCACGTTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1589s1c1
Sequence:CCGGCTTTGGAGATTTAGGACCATACTCGAGTATGGTCCTAAATCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1148s1c1
Sequence:CCGGCAAACAGTCCTAGTTTCTGTACTCGAGTACAGAAACTAGGACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1186s1c1
Sequence:CCGGGATCTGATTGAGCCTCTCTTACTCGAGTAAGAGAGGCTCAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018502.2-1588s1c1
Sequence:CCGGCCTTTGGAGATTTAGGACCATCTCGAGATGGTCCTAAATCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1352s1c1
Sequence:CCGGCTGAAGTAGTAGGCCAGAGTTCTCGAGAACTCTGGCCTACTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018502.2-1243s1c1
Sequence:CCGGGTGCTCACAGTTCTGTGCAATCTCGAGATTGCACAGAACTGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-979s1c1
Sequence:CCGGCGATGTCTAAGCAACCTGCTACTCGAGTAGCAGGTTGCTTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1131s1c1
Sequence:CCGGCCTCAACAACCTCACTGCAAACTCGAGTTTGCAGTGAGGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1634s1c1
Sequence:CCGGCACACCTAAGCCAAGACCTTTCTCGAGAAAGGTCTTGGCTTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018502
VALIDATED
TMCO6 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1219s1c1
Sequence:CCGGGTATCTAACGTGGTGAGCGTACTCGAGTACGCTCACCACGTTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1589s1c1
Sequence:CCGGCTTTGGAGATTTAGGACCATACTCGAGTATGGTCCTAAATCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1148s1c1
Sequence:CCGGCAAACAGTCCTAGTTTCTGTACTCGAGTACAGAAACTAGGACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1186s1c1
Sequence:CCGGGATCTGATTGAGCCTCTCTTACTCGAGTAAGAGAGGCTCAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018502.2-1588s1c1
Sequence:CCGGCCTTTGGAGATTTAGGACCATCTCGAGATGGTCCTAAATCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1352s1c1
Sequence:CCGGCTGAAGTAGTAGGCCAGAGTTCTCGAGAACTCTGGCCTACTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018502.2-1243s1c1
Sequence:CCGGGTGCTCACAGTTCTGTGCAATCTCGAGATTGCACAGAACTGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-979s1c1
Sequence:CCGGCGATGTCTAAGCAACCTGCTACTCGAGTAGCAGGTTGCTTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1131s1c1
Sequence:CCGGCCTCAACAACCTCACTGCAAACTCGAGTTTGCAGTGAGGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1634s1c1
Sequence:CCGGCACACCTAAGCCAAGACCTTTCTCGAGAAAGGTCTTGGCTTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018502
VALIDATED
TMCO6 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1219s1c1
Sequence:CCGGGTATCTAACGTGGTGAGCGTACTCGAGTACGCTCACCACGTTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1589s1c1
Sequence:CCGGCTTTGGAGATTTAGGACCATACTCGAGTATGGTCCTAAATCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1148s1c1
Sequence:CCGGCAAACAGTCCTAGTTTCTGTACTCGAGTACAGAAACTAGGACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1186s1c1
Sequence:CCGGGATCTGATTGAGCCTCTCTTACTCGAGTAAGAGAGGCTCAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018502.2-1588s1c1
Sequence:CCGGCCTTTGGAGATTTAGGACCATCTCGAGATGGTCCTAAATCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-1352s1c1
Sequence:CCGGCTGAAGTAGTAGGCCAGAGTTCTCGAGAACTCTGGCCTACTACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018502.2-1243s1c1
Sequence:CCGGGTGCTCACAGTTCTGTGCAATCTCGAGATTGCACAGAACTGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018502.2-979s1c1
Sequence:CCGGCGATGTCTAAGCAACCTGCTACTCGAGTAGCAGGTTGCTTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018502.2-1131s1c1
Sequence:CCGGCCTCAACAACCTCACTGCAAACTCGAGTTTGCAGTGAGGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018502.2-1634s1c1
Sequence:CCGGCACACCTAAGCCAAGACCTTTCTCGAGAAAGGTCTTGGCTTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028036
TMCO6 MISSION shRNA Bacterial Glycerol Stock
transmembrane and coiled-coil domains 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-880s21c1
Sequence:CCGGGCTTGGTGCCTTCACTATATCCTCGAGGATATAGTGAAGGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028036.3-1634s21c1
Sequence:CCGGGGGTCTCCTACTTCACTTTAGCTCGAGCTAAAGTGAAGTAGGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1111s21c1
Sequence:CCGGCGACTTGTGGCAGCCTTATTTCTCGAGAAATAAGGCTGCCACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1583s21c1
Sequence:CCGGGATGACCTGGCTGCTCAATATCTCGAGATATTGAGCAGCCAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1267s21c1
Sequence:CCGGCAGTTGTTGCCACTATCAAATCTCGAGATTTGATAGTGGCAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028036
TMCO6 MISSION shRNA shRNA Plasmid DNA
transmembrane and coiled-coil domains 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-880s21c1
Sequence:CCGGGCTTGGTGCCTTCACTATATCCTCGAGGATATAGTGAAGGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028036.3-1634s21c1
Sequence:CCGGGGGTCTCCTACTTCACTTTAGCTCGAGCTAAAGTGAAGTAGGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1111s21c1
Sequence:CCGGCGACTTGTGGCAGCCTTATTTCTCGAGAAATAAGGCTGCCACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1583s21c1
Sequence:CCGGGATGACCTGGCTGCTCAATATCTCGAGATATTGAGCAGCCAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1267s21c1
Sequence:CCGGCAGTTGTTGCCACTATCAAATCTCGAGATTTGATAGTGGCAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028036
TMCO6 MISSION shRNA Lentiviral Transduction Particles
transmembrane and coiled-coil domains 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-880s21c1
Sequence:CCGGGCTTGGTGCCTTCACTATATCCTCGAGGATATAGTGAAGGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028036.3-1634s21c1
Sequence:CCGGGGGTCTCCTACTTCACTTTAGCTCGAGCTAAAGTGAAGTAGGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1111s21c1
Sequence:CCGGCGACTTGTGGCAGCCTTATTTCTCGAGAAATAAGGCTGCCACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1583s21c1
Sequence:CCGGGATGACCTGGCTGCTCAATATCTCGAGATATTGAGCAGCCAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028036.3-1267s21c1
Sequence:CCGGCAGTTGTTGCCACTATCAAATCTCGAGATTTGATAGTGGCAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks