EMAIL THIS PAGE TO A FRIEND

TMED10

transmembrane emp24-like trafficking protein 10 (yeast)

Synonyms: P24(DELTA) S31I125 S31III125 TMP21 Tmp-21-I p23
UniProtKB ID: P49755, B2R605, Q15602, Q16536, Q86TC2, Q86TS5
Gene ID:
Human(10972) Summary: This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8. [provided by RefSeq, Jul 2008]
Mouse(68581) transmembrane emp24-like trafficking protein 10 (yeast)
Rat(84599) transmembrane emp24-like trafficking protein 10 (yeast)
Zebrafish(326716) transmembrane emp24-like trafficking protein 10 (yeast)
chicken(423362) transmembrane emp24-like trafficking protein 10 (yeast)
dog(610559) transmembrane emp24-like trafficking protein 10 (yeast)
domestic cat(101097492) transmembrane emp24-like trafficking protein 10 (yeast)
domestic guinea pig(100713295) transmembrane emp24-like trafficking protein 10 (yeast)
naked mole-rat(101719423) transmembrane emp24-like trafficking protein 10 (yeast)
Domestic Rabbit(100009296) transmembrane emp24-like trafficking protein 10 (yeast)
cow(529761) transmembrane emp24-like trafficking protein 10 (yeast)
sheep(101109882) transmembrane emp24-like trafficking protein 10 (yeast)
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006827 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105541 MISSION® esiRNA esiRNA human TMED10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006827 Rosetta Predictions human pricing
NM_053467 Rosetta Predictions rat pricing
NM_026775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133310 predicted 534
2 SASI_Hs02_00342383 predicted 735
3 SASI_Hs01_00133304 predicted 743
4 SASI_Hs01_00133312 predicted 709
5 SASI_Hs01_00133305 predicted 575
6 SASI_Hs01_00133306 predicted 594
7 SASI_Hs01_00133313 predicted 613
8 SASI_Hs01_00133307 predicted 611
9 SASI_Hs02_00342384 predicted 706
10 SASI_Hs02_00342385 predicted 715
11 SASI_Hs01_00133308 predicted 580
12 SASI_Hs01_00133309 predicted 203
13 SASI_Hs01_00133311 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103056 predicted 375
2 SASI_Rn01_00103057 predicted 538
3 SASI_Rn01_00103058 predicted 276
4 SASI_Rn01_00103059 predicted 631
5 SASI_Rn01_00103061 predicted 337
6 SASI_Rn01_00103062 predicted 344
7 SASI_Rn02_00266060 predicted 619
8 SASI_Rn01_00103063 predicted 345
9 SASI_Rn01_00103064 predicted 639
10 SASI_Rn01_00103065 predicted 651
11 SASI_Rn01_00103060 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330844 predicted 568
2 SASI_Mm02_00330845 predicted 1187
3 SASI_Mm01_00160775 predicted 686
4 SASI_Mm01_00160776 predicted 573
5 SASI_Mm02_00330846 predicted 330
6 SASI_Mm02_00330847 predicted 273
7 SASI_Mm02_00330848 predicted 331
8 SASI_Mm01_00160781 predicted 220
9 SASI_Mm02_00330849 predicted 1212
10 SASI_Mm02_00330850 predicted 395
11 SASI_Mm01_00160772 predicted 435
12 SASI_Mm01_00160773 predicted 412
13 SASI_Mm01_00160774 predicted 601
14 SASI_Mm01_00160777 predicted 639
15 SASI_Mm01_00160778 predicted 301
16 SASI_Mm01_00160779 predicted 424
17 SASI_Mm01_00160780 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026775
VALIDATED
TMED10 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24-like trafficking protein 10 (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-509s1c1
Sequence:CCGGCGAGTCCATTGTTAATGACTTCTCGAGAAGTCATTAACAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-587s1c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-249s1c1
Sequence:CCGGACCCACCTCAAGATCACAGATCTCGAGATCTGTGATCTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-387s1c1
Sequence:CCGGCCTGACCAACTCGTGATTCTACTCGAGTAGAATCACGAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-1062s1c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-281s21c1
Sequence:CCGGACAGATTCTGCTGGCCATATTCTCGAGAATATGGCCAGCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-1079s21c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-604s21c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026775.4-693s21c1
Sequence:CCGGCCAAGAAGTTGATAGAGTAATCTCGAGATTACTCTATCAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026775
VALIDATED
TMED10 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24-like trafficking protein 10 (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-509s1c1
Sequence:CCGGCGAGTCCATTGTTAATGACTTCTCGAGAAGTCATTAACAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-587s1c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-249s1c1
Sequence:CCGGACCCACCTCAAGATCACAGATCTCGAGATCTGTGATCTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-387s1c1
Sequence:CCGGCCTGACCAACTCGTGATTCTACTCGAGTAGAATCACGAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-1062s1c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-281s21c1
Sequence:CCGGACAGATTCTGCTGGCCATATTCTCGAGAATATGGCCAGCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-1079s21c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-604s21c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026775.4-693s21c1
Sequence:CCGGCCAAGAAGTTGATAGAGTAATCTCGAGATTACTCTATCAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026775
VALIDATED
TMED10 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24-like trafficking protein 10 (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-509s1c1
Sequence:CCGGCGAGTCCATTGTTAATGACTTCTCGAGAAGTCATTAACAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-587s1c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026775.2-249s1c1
Sequence:CCGGACCCACCTCAAGATCACAGATCTCGAGATCTGTGATCTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-387s1c1
Sequence:CCGGCCTGACCAACTCGTGATTCTACTCGAGTAGAATCACGAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026775.2-1062s1c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-281s21c1
Sequence:CCGGACAGATTCTGCTGGCCATATTCTCGAGAATATGGCCAGCAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-1079s21c1
Sequence:CCGGGCCTTGTCCTTCACTCTAGTTCTCGAGAACTAGAGTGAAGGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026775.4-604s21c1
Sequence:CCGGCCGGGTCCTGTACTTCAGCATCTCGAGATGCTGAAGTACAGGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026775.4-693s21c1
Sequence:CCGGCCAAGAAGTTGATAGAGTAATCTCGAGATTACTCTATCAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006827
VALIDATED
TMED10 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24-like trafficking protein 10 (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006827.4-468s1c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-368s1c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-150s1c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-639s1c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-553s1c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-524s21c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-424s21c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-609s21c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-695s21c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-206s21c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006827
VALIDATED
TMED10 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24-like trafficking protein 10 (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006827.4-468s1c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-368s1c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-150s1c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-639s1c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-553s1c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-524s21c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-424s21c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-609s21c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-695s21c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-206s21c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006827
VALIDATED
TMED10 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24-like trafficking protein 10 (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006827.4-468s1c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-368s1c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-150s1c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-639s1c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006827.4-553s1c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-524s21c1
Sequence:CCGGCGCCTAGAAGACCTTTCAGAACTCGAGTTCTGAAAGGTCTTCTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-424s21c1
Sequence:CCGGCCAACTCGTGATCCTAGACATCTCGAGATGTCTAGGATCACGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-609s21c1
Sequence:CCGGCAACAAACACTCGGGTCCTATCTCGAGATAGGACCCGAGTGTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-695s21c1
Sequence:CCGGCGCTTCTTCAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006827.5-206s21c1
Sequence:CCGGGAGATTCACAAGGACCTGCTACTCGAGTAGCAGGTCCTTGTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks