EMAIL THIS PAGE TO A FRIEND

TMED1

transmembrane emp24 protein transport domain containing 1

Synonyms: IL1RL1LG Il1rl1l Tp24
UniProtKB ID: Q13445
Gene ID:
Human(11018) Summary: The protein encoded by this gene was identified by its interaction with interleukin 1 receptor-like 1 (IL1RL1). This protein lacks any similarity to other interleukin 1 ligands. The functional significance of its interaction with IL1RL1 is not known. [provided by RefSeq, Jul 2008]
Mouse(17083) transmembrane emp24 domain containing 1
Rat(315461) transmembrane emp24 protein transport domain containing 1
cow(538144) transmembrane emp24 protein transport domain containing 1
sheep(101119305) transmembrane emp24 protein transport domain containing 1
naked mole-rat(101699087) transmembrane emp24 protein transport domain containing 1
domestic guinea pig(100718715) transmembrane emp24 protein transport domain containing 1
domestic cat(101096544) transmembrane emp24 protein transport domain containing 1
dog(484948) transmembrane emp24 protein transport domain containing 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007091 MISSION® esiRNA esiRNA targeting human TMED1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006858 Rosetta Predictions human pricing
NM_001013432 Rosetta Predictions rat pricing
NM_010744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021210 predicted 453
2 SASI_Hs01_00021211 predicted 546
3 SASI_Hs01_00021212 predicted 451
4 SASI_Hs01_00021213 predicted 955
5 SASI_Hs01_00021214 predicted 1078
6 SASI_Hs01_00021215 predicted 961
7 SASI_Hs01_00021216 predicted 617
8 SASI_Hs01_00021217 predicted 613
9 SASI_Hs01_00021218 predicted 468
10 SASI_Hs01_00021219 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113495 predicted 427
2 SASI_Rn01_00113496 predicted 534
3 SASI_Rn01_00113497 predicted 355
4 SASI_Rn01_00113500 predicted 299
5 SASI_Rn02_00201105 predicted 327
6 SASI_Rn01_00113501 predicted 579
7 SASI_Rn02_00201106 predicted 385
8 SASI_Rn01_00113502 predicted 289
9 SASI_Rn01_00113504 predicted 550
10 SASI_Rn02_00201107 predicted 508
11 SASI_Rn01_00113498 predicted 1100
12 SASI_Rn01_00113499 predicted 435
13 SASI_Rn01_00113503 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115635 predicted 761
2 SASI_Mm01_00115636 predicted 508
3 SASI_Mm01_00115637 predicted 959
4 SASI_Mm01_00115638 predicted 360
5 SASI_Mm01_00115640 predicted 937
6 SASI_Mm01_00115641 predicted 303
7 SASI_Mm01_00115642 predicted 257
8 SASI_Mm01_00115644 predicted 299
9 SASI_Mm02_00319253 predicted 544
10 SASI_Mm02_00319254 predicted 516
11 SASI_Mm01_00115639 predicted 1108
12 SASI_Mm01_00115643 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006858
VALIDATED
TMED1 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-311s21c1
Sequence:CCGGTGCTGGACTGGACGTGGACTTCTCGAGAAGTCCACGTCCAGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-573s21c1
Sequence:CCGGGACATCAAGGAGTCCATTGAGCTCGAGCTCAATGGACTCCTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-620s21c1
Sequence:CCGGCATCCAGATGCTCACGCTACTCTCGAGAGTAGCGTGAGCATCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-155s21c1
Sequence:CCGGGCTACTAATGCCACCAGTGGACTCGAGTCCACTGGTGGCATTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-420s21c1
Sequence:CCGGGACTACAAGCTGTGCTTTGACCTCGAGGTCAAAGCACAGCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006858.2-1046s21c1
Sequence:CCGGTGGAACGTGAGCCTCGGATTTCTCGAGAAATCCGAGGCTCACGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-1074s1c1
Sequence:CCGGCCTCTACTGTAAATGTGCCTTCTCGAGAAGGCACATTTACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-471s1c1
Sequence:CCGGGTGTTCTTTGAACTGATCTTTCTCGAGAAAGATCAGTTCAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006858.2-284s1c1
Sequence:CCGGCGAGACCGAATACCAGGTGATCTCGAGATCACCTGGTATTCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-695s1c1
Sequence:CCGGCAACTTCTGGTCAGCTGTCAACTCGAGTTGACAGCTGACCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-543s1c1
Sequence:CCGGCCCGAGGAGATGCTGGATGTTCTCGAGAACATCCAGCATCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006858
VALIDATED
TMED1 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-311s21c1
Sequence:CCGGTGCTGGACTGGACGTGGACTTCTCGAGAAGTCCACGTCCAGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-573s21c1
Sequence:CCGGGACATCAAGGAGTCCATTGAGCTCGAGCTCAATGGACTCCTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-620s21c1
Sequence:CCGGCATCCAGATGCTCACGCTACTCTCGAGAGTAGCGTGAGCATCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-155s21c1
Sequence:CCGGGCTACTAATGCCACCAGTGGACTCGAGTCCACTGGTGGCATTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-420s21c1
Sequence:CCGGGACTACAAGCTGTGCTTTGACCTCGAGGTCAAAGCACAGCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006858.2-1046s21c1
Sequence:CCGGTGGAACGTGAGCCTCGGATTTCTCGAGAAATCCGAGGCTCACGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-1074s1c1
Sequence:CCGGCCTCTACTGTAAATGTGCCTTCTCGAGAAGGCACATTTACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-471s1c1
Sequence:CCGGGTGTTCTTTGAACTGATCTTTCTCGAGAAAGATCAGTTCAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006858.2-284s1c1
Sequence:CCGGCGAGACCGAATACCAGGTGATCTCGAGATCACCTGGTATTCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-695s1c1
Sequence:CCGGCAACTTCTGGTCAGCTGTCAACTCGAGTTGACAGCTGACCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-543s1c1
Sequence:CCGGCCCGAGGAGATGCTGGATGTTCTCGAGAACATCCAGCATCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006858
VALIDATED
TMED1 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-311s21c1
Sequence:CCGGTGCTGGACTGGACGTGGACTTCTCGAGAAGTCCACGTCCAGTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-573s21c1
Sequence:CCGGGACATCAAGGAGTCCATTGAGCTCGAGCTCAATGGACTCCTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-620s21c1
Sequence:CCGGCATCCAGATGCTCACGCTACTCTCGAGAGTAGCGTGAGCATCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-155s21c1
Sequence:CCGGGCTACTAATGCCACCAGTGGACTCGAGTCCACTGGTGGCATTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006858.2-420s21c1
Sequence:CCGGGACTACAAGCTGTGCTTTGACCTCGAGGTCAAAGCACAGCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006858.2-1046s21c1
Sequence:CCGGTGGAACGTGAGCCTCGGATTTCTCGAGAAATCCGAGGCTCACGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-1074s1c1
Sequence:CCGGCCTCTACTGTAAATGTGCCTTCTCGAGAAGGCACATTTACAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-471s1c1
Sequence:CCGGGTGTTCTTTGAACTGATCTTTCTCGAGAAAGATCAGTTCAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006858.2-284s1c1
Sequence:CCGGCGAGACCGAATACCAGGTGATCTCGAGATCACCTGGTATTCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-695s1c1
Sequence:CCGGCAACTTCTGGTCAGCTGTCAACTCGAGTTGACAGCTGACCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006858.2-543s1c1
Sequence:CCGGCCCGAGGAGATGCTGGATGTTCTCGAGAACATCCAGCATCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010744
VALIDATED
TMED1 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-253s21c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-103s21c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-551s21c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-158s21c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-130s21c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-131s1c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-691s1c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-254s1c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-159s1c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-104s1c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010744
VALIDATED
TMED1 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-253s21c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-103s21c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-551s21c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-158s21c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-130s21c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-131s1c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-691s1c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-254s1c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-159s1c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-104s1c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010744
VALIDATED
TMED1 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-253s21c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-103s21c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-551s21c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-158s21c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010744.3-130s21c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-131s1c1
Sequence:CCGGCGGGAGAAAGCAGTGTTTCTACTCGAGTAGAAACACTGCTTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-691s1c1
Sequence:CCGGCGTGATCGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-254s1c1
Sequence:CCGGGTTGGTCAGTGAGTCTCGAAACTCGAGTTTCGAGACTCACTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-159s1c1
Sequence:CCGGGCACCGGCCAATGCTAGTCTTCTCGAGAAGACTAGCATTGGCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010744.1-104s1c1
Sequence:CCGGCGGCGAGTTCACATTTCTGCTCTCGAGAGCAGAAATGTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks