EMAIL THIS PAGE TO A FRIEND

TMED2

transmembrane emp24 domain trafficking protein 2

Synonyms: P24A RNP24 p24
UniProtKB ID: Q15363
Gene ID:
Mouse(56334) transmembrane emp24 domain trafficking protein 2
Rat(65165) transmembrane emp24 domain trafficking protein 2
Zebrafish(321550) transmembrane emp24 domain trafficking protein 2
chicken(416821) transmembrane emp24 domain trafficking protein 2
dog(100687986) transmembrane emp24 domain trafficking protein 2
domestic cat(101100419) transmembrane emp24 domain trafficking protein 2
domestic guinea pig(100720577) transmembrane emp24 domain trafficking protein 2
naked mole-rat(101698066) transmembrane emp24 domain trafficking protein 2
cow(100140040) transmembrane emp24 domain trafficking protein 2
sheep(101122056) transmembrane emp24 domain trafficking protein 2
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006815 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006815 Rosetta Predictions human pricing
NM_031722 Rosetta Predictions rat pricing
NM_019770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037269 predicted 357
2 SASI_Hs02_00342354 predicted 328
3 SASI_Hs02_00342355 predicted 458
4 SASI_Hs02_00342356 predicted 321
5 SASI_Hs01_00037272 predicted 721
6 SASI_Hs01_00037273 predicted 416
7 SASI_Hs01_00037275 predicted 297
8 SASI_Hs02_00342357 predicted 464
9 SASI_Hs01_00037278 predicted 762
10 SASI_Hs02_00342358 predicted 804
11 SASI_Hs01_00037270 predicted 547
12 SASI_Hs01_00037271 predicted 654
13 SASI_Hs01_00037274 predicted 505
14 SASI_Hs01_00037276 predicted 555
15 SASI_Hs01_00037277 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037749 predicted 611
2 SASI_Rn01_00037752 predicted 660
3 SASI_Rn01_00037755 predicted 668
4 SASI_Rn01_00037757 predicted 569
5 SASI_Rn02_00265093 predicted 604
6 SASI_Rn02_00265094 predicted 350
7 SASI_Rn02_00265095 predicted 676
8 SASI_Rn02_00265096 predicted 756
9 SASI_Rn02_00265097 predicted 577
10 SASI_Rn02_00265098 predicted 704
11 SASI_Rn01_00037748 predicted 432
12 SASI_Rn01_00037750 predicted 236
13 SASI_Rn01_00037751 predicted 361
14 SASI_Rn01_00037753 predicted 326
15 SASI_Rn01_00037754 predicted 318
16 SASI_Rn01_00037756 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166896 predicted 375
2 SASI_Mm01_00166901 predicted 369
3 SASI_Mm01_00166903 predicted 327
4 SASI_Mm01_00166897 predicted 450
5 SASI_Mm01_00166898 predicted 444
6 SASI_Mm01_00166899 predicted 586
7 SASI_Mm01_00166900 predicted 383
8 SASI_Mm01_00166902 predicted 490
9 SASI_Mm01_00166904 predicted 621
10 SASI_Mm01_00166905 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019770
TMED2 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 domain trafficking protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019770.2-1275s1c1
Sequence:CCGGGCCAATAACTTAGCCGTTCTTCTCGAGAAGAACGGCTAAGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-247s1c1
Sequence:CCGGTGGAGATCACAGGACCAGATACTCGAGTATCTGGTCCTGTGATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-444s1c1
Sequence:CCGGGCTCATCAGAACAAGCTAGAACTCGAGTTCTAGCTTGTTCTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-365s1c1
Sequence:CCGGGTCCACTATGACTCCAAAGATCTCGAGATCTTTGGAGTCATAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-547s1c1
Sequence:CCGGGAGCCATCAATGACAACACAACTCGAGTTGTGTTGTCATTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019770
TMED2 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 domain trafficking protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019770.2-1275s1c1
Sequence:CCGGGCCAATAACTTAGCCGTTCTTCTCGAGAAGAACGGCTAAGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-247s1c1
Sequence:CCGGTGGAGATCACAGGACCAGATACTCGAGTATCTGGTCCTGTGATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-444s1c1
Sequence:CCGGGCTCATCAGAACAAGCTAGAACTCGAGTTCTAGCTTGTTCTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-365s1c1
Sequence:CCGGGTCCACTATGACTCCAAAGATCTCGAGATCTTTGGAGTCATAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-547s1c1
Sequence:CCGGGAGCCATCAATGACAACACAACTCGAGTTGTGTTGTCATTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019770
TMED2 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 domain trafficking protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019770.2-1275s1c1
Sequence:CCGGGCCAATAACTTAGCCGTTCTTCTCGAGAAGAACGGCTAAGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-247s1c1
Sequence:CCGGTGGAGATCACAGGACCAGATACTCGAGTATCTGGTCCTGTGATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-444s1c1
Sequence:CCGGGCTCATCAGAACAAGCTAGAACTCGAGTTCTAGCTTGTTCTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-365s1c1
Sequence:CCGGGTCCACTATGACTCCAAAGATCTCGAGATCTTTGGAGTCATAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019770.2-547s1c1
Sequence:CCGGGAGCCATCAATGACAACACAACTCGAGTTGTGTTGTCATTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006815
VALIDATED
TMED2 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 domain trafficking protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-450s1c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-277s1c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006815.2-499s1c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-209s1c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-77s1c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-294s21c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-584s21c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-162s21c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-362s21c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-535s21c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006815
VALIDATED
TMED2 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 domain trafficking protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-450s1c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-277s1c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006815.2-499s1c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-209s1c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-77s1c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-294s21c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-584s21c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-162s21c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-362s21c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-535s21c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006815
VALIDATED
TMED2 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 domain trafficking protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-450s1c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-277s1c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006815.2-499s1c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-209s1c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006815.2-77s1c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-294s21c1
Sequence:CCGGAGGACCAGATAACAAAGGAATCTCGAGATTCCTTTGTTATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-584s21c1
Sequence:CCGGGAGCCATCAACGACAACACAACTCGAGTTGTGTTGTCGTTGATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-162s21c1
Sequence:CCGGCTCGGGCTATTTCGTTAGCATCTCGAGATGCTAACGAAATAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-362s21c1
Sequence:CCGGACATGGATGGAACATACAAATCTCGAGATTTGTATGTTCCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006815.3-535s21c1
Sequence:CCGGGCTGTAAAGCACGAACAGGAACTCGAGTTCCTGTTCGTGCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks