EMAIL THIS PAGE TO A FRIEND

TMED3

transmembrane emp24 protein transport domain containing 3

Synonyms: C15orf22 P24B p26
UniProtKB ID: Q9Y3Q3, A8K069, B4DN05, Q2T9F8
Gene ID:
Mouse(66111) transmembrane emp24 domain containing 3
Rat(300888) transmembrane emp24 protein transport domain containing 3
sheep(101113536) transmembrane emp24 protein transport domain containing 3
naked mole-rat(101698395) transmembrane emp24 protein transport domain containing 3
domestic guinea pig(100732426) transmembrane emp24 protein transport domain containing 3
Zebrafish(336391) transmembrane emp24 protein transport domain containing 3
domestic cat(101093189) transmembrane emp24 protein transport domain containing 3
chicken(415580) transmembrane emp24 protein transport domain containing 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007364 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007364 Rosetta Predictions human pricing
NM_001004249 Rosetta Predictions rat pricing
NM_025360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024382 predicted 554
2 SASI_Hs01_00024383 predicted 660
3 SASI_Hs02_00343487 predicted 729
4 SASI_Hs01_00024385 predicted 1046
5 SASI_Hs02_00343488 predicted 682
6 SASI_Hs01_00024386 predicted 854
7 SASI_Hs01_00024387 predicted 1133
8 SASI_Hs01_00024388 predicted 877
9 SASI_Hs01_00024389 predicted 369
10 SASI_Hs02_00343489 predicted 892
11 SASI_Hs01_00024380 predicted 284
12 SASI_Hs01_00024381 predicted 672
13 SASI_Hs01_00024384 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051624 predicted 401
2 SASI_Rn01_00051625 predicted 531
3 SASI_Rn01_00051626 predicted 573
4 SASI_Rn01_00051627 predicted 651
5 SASI_Rn01_00051628 predicted 740
6 SASI_Rn02_00198264 predicted 262
7 SASI_Rn01_00051629 predicted 849
8 SASI_Rn01_00051630 predicted 677
9 SASI_Rn01_00051631 predicted 416
10 SASI_Rn01_00051633 predicted 891
11 SASI_Rn01_00051632 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055493 predicted 827
2 SASI_Mm01_00055494 predicted 833
3 SASI_Mm01_00055495 predicted 490
4 SASI_Mm02_00328058 predicted 223
5 SASI_Mm02_00328059 predicted 1012
6 SASI_Mm01_00055496 predicted 645
7 SASI_Mm01_00055497 predicted 245
8 SASI_Mm01_00055498 predicted 704
9 SASI_Mm01_00055499 predicted 631
10 SASI_Mm01_00055501 predicted 961
11 SASI_Mm01_00055500 predicted 419
12 SASI_Mm01_00055502 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025360
VALIDATED
TMED3 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-327s21c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-587s21c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025360.1-964s21c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-221s21c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-964s1c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-327s1c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025360.1-587s1c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-405s1c1
Sequence:CCGGCTCTCATAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-221s1c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025360
VALIDATED
TMED3 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-327s21c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-587s21c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025360.1-964s21c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-221s21c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-964s1c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-327s1c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025360.1-587s1c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-405s1c1
Sequence:CCGGCTCTCATAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-221s1c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025360
VALIDATED
TMED3 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-327s21c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-587s21c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025360.1-964s21c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025360.1-221s21c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-964s1c1
Sequence:CCGGGCCAGTGATCTAGCATCCAATCTCGAGATTGGATGCTAGATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-327s1c1
Sequence:CCGGGCAGTATGACAGCTTCACGTACTCGAGTACGTGAAGCTGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025360.1-587s1c1
Sequence:CCGGCCCGAGCTGAAGACCTTAATACTCGAGTATTAAGGTCTTCAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-405s1c1
Sequence:CCGGCTCTCATAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTATGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025360.1-221s1c1
Sequence:CCGGGCGTGAAGTTCTCTCTGGATTCTCGAGAATCCAGAGAGAACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007364
VALIDATED
TMED3 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-633s21c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-375s21c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-428s21c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-610s21c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-425s1c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-607s1c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-372s1c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-630s1c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-282s1c1
Sequence:CCGGCACTACGATGTTGACTGCTATCTCGAGATAGCAGTCAACATCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007364
VALIDATED
TMED3 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-633s21c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-375s21c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-428s21c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-610s21c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-425s1c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-607s1c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-372s1c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-630s1c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-282s1c1
Sequence:CCGGCACTACGATGTTGACTGCTATCTCGAGATAGCAGTCAACATCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007364
VALIDATED
TMED3 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-633s21c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-375s21c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-428s21c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007364.2-610s21c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-425s1c1
Sequence:CCGGCTCTCACAAGACCGTCTACTTCTCGAGAAGTAGACGGTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-607s1c1
Sequence:CCGGCCCGAGCGGAAGACCTTAATACTCGAGTATTAAGGTCTTCCGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-372s1c1
Sequence:CCGGGCTGAAGTCAAGGGCGTTTATCTCGAGATAAACGCCCTTGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-630s1c1
Sequence:CCGGCGAGTCTCTTACTGGTCTGTTCTCGAGAACAGACCAGTAAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007364.1-282s1c1
Sequence:CCGGCACTACGATGTTGACTGCTATCTCGAGATAGCAGTCAACATCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks