EMAIL THIS PAGE TO A FRIEND

TMED4

transmembrane emp24 protein transport domain containing 4

Synonyms: ERS25 HNLF
UniProtKB ID: Q7Z7H5, A4D2K8, B4DFJ4, Q56VW3, Q7Z432, Q8N2P6
Gene ID:
Mouse(103694) transmembrane emp24 protein transport domain containing 4
Rat(305502) transmembrane emp24 protein transport domain containing 4
Zebrafish(415224) transmembrane emp24 protein transport domain containing 4
domestic cat(101095809) transmembrane emp24 protein transport domain containing 4
dog(475498) transmembrane emp24 protein transport domain containing 4
domestic guinea pig(100725631) transmembrane emp24 protein transport domain containing 4
naked mole-rat(101715864) transmembrane emp24 protein transport domain containing 4
cow(508729) transmembrane emp24 protein transport domain containing 4
sheep(101115957) transmembrane emp24 protein transport domain containing 4
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701905 Anti-tmed4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV41191 Anti-TMED4 antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, bovine, rat, zebrafish, horse, rabbit
western blot pricing
AV41190 Anti-TMED4 antibody produced in rabbit IgG fraction of antiserum bovine, human, mouse, guinea pig, rat, zebrafish, rabbit
immunohistochemistry, western blot pricing
SAB2701140 Anti-TMED4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182547 Rosetta Predictions human pricing
NM_001107238 Rosetta Predictions rat pricing
NM_134020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174209 predicted 410
2 SASI_Hs01_00174210 predicted 239
3 SASI_Hs02_00370659 predicted 314
4 SASI_Hs01_00174212 predicted 533
5 SASI_Hs01_00174213 predicted 523
6 SASI_Hs01_00174214 predicted 501
7 SASI_Hs02_00370660 predicted 352
8 SASI_Hs01_00174217 predicted 396
9 SASI_Hs01_00174218 predicted 340
10 SASI_Hs02_00370661 predicted 539
11 SASI_Hs01_00174211 predicted 536
12 SASI_Hs01_00174215 predicted 547
13 SASI_Hs01_00174216 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226875 predicted 474
2 SASI_Rn02_00226876 predicted 1065
3 SASI_Rn02_00226877 predicted 1039
4 SASI_Rn02_00226878 predicted 1020
5 SASI_Rn02_00226879 predicted 1013
6 SASI_Rn02_00226880 predicted 1177
7 SASI_Rn02_00226881 predicted 466
8 SASI_Rn02_00226882 predicted 921
9 SASI_Rn02_00226883 predicted 597
10 SASI_Rn02_00226884 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021519 predicted 319
2 SASI_Mm01_00021520 predicted 925
3 SASI_Mm01_00021521 predicted 1120
4 SASI_Mm01_00021522 predicted 1051
5 SASI_Mm01_00021523 predicted 992
6 SASI_Mm01_00021524 predicted 1079
7 SASI_Mm02_00339178 predicted 909
8 SASI_Mm01_00021525 predicted 891
9 SASI_Mm01_00021526 predicted 439
10 SASI_Mm01_00021527 predicted 259
11 SASI_Mm01_00021528 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134020
VALIDATED
TMED4 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-942s1c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-163s1c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-521s1c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-173s1c1
Sequence:CCGGCGAACTCAGATGTGGGACAAACTCGAGTTTGTCCCACATCTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-122s1c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-521s21c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134020.1-942s21c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-163s21c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-122s21c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134020
VALIDATED
TMED4 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-942s1c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-163s1c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-521s1c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-173s1c1
Sequence:CCGGCGAACTCAGATGTGGGACAAACTCGAGTTTGTCCCACATCTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-122s1c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-521s21c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134020.1-942s21c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-163s21c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-122s21c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134020
VALIDATED
TMED4 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-942s1c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-163s1c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-521s1c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-173s1c1
Sequence:CCGGCGAACTCAGATGTGGGACAAACTCGAGTTTGTCCCACATCTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134020.1-122s1c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-521s21c1
Sequence:CCGGGAGCAGGATTATCAGAGGTATCTCGAGATACCTCTGATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134020.1-942s21c1
Sequence:CCGGCCCAAGGTCAAGTCCTTTCTTCTCGAGAAGAAAGGACTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-163s21c1
Sequence:CCGGCGGCAACTATCGAACTCAGATCTCGAGATCTGAGTTCGATAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134020.1-122s21c1
Sequence:CCGGCGCTGCTTCATCGAGGAAATACTCGAGTATTTCCTCGATGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182547
TMED4 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182547.2-861s1c1
Sequence:CCGGCCCTGGTTCTTAAGGACACATCTCGAGATGTGTCCTTAAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-139s1c1
Sequence:CCGGGCGCTGTTTCATCGAGGAAATCTCGAGATTTCCTCGATGAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-443s1c1
Sequence:CCGGGCCAACAACTACCCTGAGATTCTCGAGAATCTCAGGGTAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-442s1c1
Sequence:CCGGTGCCAACAACTACCCTGAGATCTCGAGATCTCAGGGTAGTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-539s1c1
Sequence:CCGGGAGCAGGATTACCAAAGGTATCTCGAGATACCTTTGGTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182547
TMED4 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182547.2-861s1c1
Sequence:CCGGCCCTGGTTCTTAAGGACACATCTCGAGATGTGTCCTTAAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-139s1c1
Sequence:CCGGGCGCTGTTTCATCGAGGAAATCTCGAGATTTCCTCGATGAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-443s1c1
Sequence:CCGGGCCAACAACTACCCTGAGATTCTCGAGAATCTCAGGGTAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-442s1c1
Sequence:CCGGTGCCAACAACTACCCTGAGATCTCGAGATCTCAGGGTAGTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-539s1c1
Sequence:CCGGGAGCAGGATTACCAAAGGTATCTCGAGATACCTTTGGTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182547
TMED4 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182547.2-861s1c1
Sequence:CCGGCCCTGGTTCTTAAGGACACATCTCGAGATGTGTCCTTAAGAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-139s1c1
Sequence:CCGGGCGCTGTTTCATCGAGGAAATCTCGAGATTTCCTCGATGAAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-443s1c1
Sequence:CCGGGCCAACAACTACCCTGAGATTCTCGAGAATCTCAGGGTAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-442s1c1
Sequence:CCGGTGCCAACAACTACCCTGAGATCTCGAGATCTCAGGGTAGTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182547.2-539s1c1
Sequence:CCGGGAGCAGGATTACCAAAGGTATCTCGAGATACCTTTGGTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks