EMAIL THIS PAGE TO A FRIEND

TMED5

transmembrane emp24 protein transport domain containing 5

Synonyms: CGI-100 p28
UniProtKB ID: Q9Y3A6, B1AKT4, B2R703, D3DT38, Q96AX8
Gene ID:
Mouse(73130) transmembrane emp24 protein transport domain containing 5
Rat(289883) transmembrane emp24 protein transport domain containing 5
cow(534351) transmembrane emp24 protein transport domain containing 5
sheep(101105612) transmembrane emp24 protein transport domain containing 5
naked mole-rat(101708849) transmembrane emp24 protein transport domain containing 5
domestic guinea pig(100717428) transmembrane emp24 protein transport domain containing 5
Zebrafish(393374) transmembrane emp24 protein transport domain containing 5
domestic cat(101098153) transmembrane emp24 protein transport domain containing 5
dog(479947) transmembrane emp24 protein transport domain containing 5
chicken(424499) transmembrane emp24 protein transport domain containing 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016040 Rosetta Predictions human pricing
NM_001007619 Rosetta Predictions rat pricing
NM_028876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157841 predicted 1186
2 SASI_Hs01_00157843 predicted 1204
3 SASI_Hs01_00157844 predicted 1130
4 SASI_Hs01_00157845 predicted 1074
5 SASI_Hs01_00157846 predicted 957
6 SASI_Hs01_00157847 predicted 877
7 SASI_Hs01_00157848 predicted 1022
8 SASI_Hs02_00348759 predicted 749
9 SASI_Hs01_00157849 predicted 1139
10 SASI_Hs01_00157850 predicted 1012
11 SASI_Hs01_00157842 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119772 predicted 273
2 SASI_Rn01_00119773 predicted 962
3 SASI_Rn01_00119774 predicted 353
4 SASI_Rn01_00119775 predicted 831
5 SASI_Rn01_00119776 predicted 977
6 SASI_Rn01_00119777 predicted 861
7 SASI_Rn01_00119778 predicted 582
8 SASI_Rn01_00119779 predicted 761
9 SASI_Rn01_00119780 predicted 1056
10 SASI_Rn01_00119781 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075503 predicted 917
2 SASI_Mm01_00075504 predicted 369
3 SASI_Mm01_00075505 predicted 468
4 SASI_Mm01_00075506 predicted 679
5 SASI_Mm01_00075508 predicted 763
6 SASI_Mm01_00075509 predicted 931
7 SASI_Mm01_00075510 predicted 390
8 SASI_Mm01_00075511 predicted 711
9 SASI_Mm01_00075512 predicted 459
10 SASI_Mm02_00334552 predicted 914
11 SASI_Mm01_00075507 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016040
VALIDATED
TMED5 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016040.3-647s21c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-3604s21c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-1016s21c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-850s21c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-3604s1c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-647s1c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-850s1c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-772s1c1
Sequence:CCGGGACAATACATTCAGCACCATTCTCGAGAATGGTGCTGAATGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-1016s1c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016040
VALIDATED
TMED5 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016040.3-647s21c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-3604s21c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-1016s21c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-850s21c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-3604s1c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-647s1c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-850s1c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-772s1c1
Sequence:CCGGGACAATACATTCAGCACCATTCTCGAGAATGGTGCTGAATGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-1016s1c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016040
VALIDATED
TMED5 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016040.3-647s21c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-3604s21c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-1016s21c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016040.3-850s21c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-3604s1c1
Sequence:CCGGGCCTAGAGTTTGCTCTGATATCTCGAGATATCAGAGCAAACTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-647s1c1
Sequence:CCGGGAGCAGGATTAGATATTGATTCTCGAGAATCAATATCTAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-850s1c1
Sequence:CCGGGAACAAGAAGATTGGAAGAAACTCGAGTTTCTTCCAATCTTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016040.3-772s1c1
Sequence:CCGGGACAATACATTCAGCACCATTCTCGAGAATGGTGCTGAATGTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016040.3-1016s1c1
Sequence:CCGGGCAACTTTGATAGAGTCAATTCTCGAGAATTGACTCTATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028876
VALIDATED
TMED5 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-333s21c1
Sequence:CCGGGCATCGTTGGAGATCGAATACCTCGAGGTATTCGATCTCCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-679s21c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-530s21c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028876.2-1937s21c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-439s21c1
Sequence:CCGGCAGATGGTGTTCATACTATAGCTCGAGCTATAGTATGAACACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-1938s1c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-255s1c1
Sequence:CCGGACCCTCTTTGGACAGTGATTTCTCGAGAAATCACTGTCCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-531s1c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-680s1c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-715s1c1
Sequence:CCGGCGAGATCGAAACATACAAGAACTCGAGTTCTTGTATGTTTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028876
VALIDATED
TMED5 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-333s21c1
Sequence:CCGGGCATCGTTGGAGATCGAATACCTCGAGGTATTCGATCTCCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-679s21c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-530s21c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028876.2-1937s21c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-439s21c1
Sequence:CCGGCAGATGGTGTTCATACTATAGCTCGAGCTATAGTATGAACACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-1938s1c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-255s1c1
Sequence:CCGGACCCTCTTTGGACAGTGATTTCTCGAGAAATCACTGTCCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-531s1c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-680s1c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-715s1c1
Sequence:CCGGCGAGATCGAAACATACAAGAACTCGAGTTCTTGTATGTTTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028876
VALIDATED
TMED5 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-333s21c1
Sequence:CCGGGCATCGTTGGAGATCGAATACCTCGAGGTATTCGATCTCCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-679s21c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-530s21c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028876.2-1937s21c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028876.2-439s21c1
Sequence:CCGGCAGATGGTGTTCATACTATAGCTCGAGCTATAGTATGAACACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-1938s1c1
Sequence:CCGGGCTCCTTTCTAAATTCTCAAACTCGAGTTTGAGAATTTAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-255s1c1
Sequence:CCGGACCCTCTTTGGACAGTGATTTCTCGAGAAATCACTGTCCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-531s1c1
Sequence:CCGGCTTTGAATTGATCCTGGATAACTCGAGTTATCCAGGATCAATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-680s1c1
Sequence:CCGGGCCACATACAAACTCTACTTACTCGAGTAAGTAGAGTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028876.1-715s1c1
Sequence:CCGGCGAGATCGAAACATACAAGAACTCGAGTTCTTGTATGTTTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks