EMAIL THIS PAGE TO A FRIEND

TMED6

transmembrane emp24 protein transport domain containing 6

Synonyms: PRO34237 SPLL9146
UniProtKB ID: Q8WW62, Q6UXN5
Gene ID:
Mouse(66269) transmembrane emp24 protein transport domain containing 6
Rat(291991) transmembrane emp24 protein transport domain containing 6
chicken(101750075) transmembrane emp24 protein transport domain containing 6
dog(610951) transmembrane emp24 protein transport domain containing 6
domestic cat(101097195) transmembrane emp24 protein transport domain containing 6
domestic guinea pig(100723830) transmembrane emp24 protein transport domain containing 6
naked mole-rat(101715666) transmembrane emp24 protein transport domain containing 6
cow(533277) transmembrane emp24 protein transport domain containing 6
sheep(101121367) transmembrane emp24 protein transport domain containing 6
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029781 MISSION® esiRNA esiRNA human TMED6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144676 Rosetta Predictions human pricing
NM_001106183 Rosetta Predictions rat pricing
NM_025458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193188 predicted 553
2 SASI_Hs01_00193189 predicted 213
3 SASI_Hs02_00364575 predicted 256
4 SASI_Hs01_00193191 predicted 285
5 SASI_Hs01_00193192 predicted 658
6 SASI_Hs02_00364576 predicted 273
7 SASI_Hs01_00193193 predicted 207
8 SASI_Hs02_00364577 predicted 412
9 SASI_Hs01_00193196 predicted 684
10 SASI_Hs01_00193197 predicted 286
11 SASI_Hs01_00193190 predicted 674
12 SASI_Hs01_00193194 predicted 351
13 SASI_Hs01_00193195 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216448 predicted 404
2 SASI_Rn02_00216449 predicted 341
3 SASI_Rn02_00216450 predicted 498
4 SASI_Rn02_00216451 predicted 212
5 SASI_Rn02_00216452 predicted 456
6 SASI_Rn02_00216453 predicted 234
7 SASI_Rn02_00216454 predicted 371
8 SASI_Rn02_00216455 predicted 618
9 SASI_Rn02_00216456 predicted 426
10 SASI_Rn02_00216457 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126323 predicted 402
2 SASI_Mm02_00328293 predicted 548
3 SASI_Mm01_00126324 predicted 235
4 SASI_Mm01_00126325 predicted 500
5 SASI_Mm01_00126326 predicted 205
6 SASI_Mm01_00126327 predicted 259
7 SASI_Mm02_00328294 predicted 423
8 SASI_Mm01_00126329 predicted 336
9 SASI_Mm01_00126330 predicted 371
10 SASI_Mm01_00126331 predicted 418
11 SASI_Mm01_00126328 predicted 256
12 SASI_Mm01_00126332 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025458
VALIDATED
TMED6 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-217s1c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-190s1c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-188s1c1
Sequence:CCGGGCCATCGAATGTTTCTGGCAACTCGAGTTGCCAGAAACATTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-412s1c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-403s1c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-216s21c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-189s21c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-411s21c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-402s21c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025458
VALIDATED
TMED6 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-217s1c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-190s1c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-188s1c1
Sequence:CCGGGCCATCGAATGTTTCTGGCAACTCGAGTTGCCAGAAACATTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-412s1c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-403s1c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-216s21c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-189s21c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-411s21c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-402s21c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025458
VALIDATED
TMED6 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-217s1c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025458.1-190s1c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-188s1c1
Sequence:CCGGGCCATCGAATGTTTCTGGCAACTCGAGTTGCCAGAAACATTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-412s1c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025458.1-403s1c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-216s21c1
Sequence:CCGGCCAGATGGGATACCTCTACTTCTCGAGAAGTAGAGGTATCCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-189s21c1
Sequence:CCGGCATCGAATGTTTCTGGCAATTCTCGAGAATTGCCAGAAACATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-411s21c1
Sequence:CCGGCTTCAGTTCTATACAAGTGTACTCGAGTACACTTGTATAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025458.2-402s21c1
Sequence:CCGGGCAGAATCGCTTCAGTTCTATCTCGAGATAGAACTGAAGCGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144676
TMED6 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-540s1c1
Sequence:CCGGGCAGAACAATATCTTTCACATCTCGAGATGTGAAAGATATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-655s1c1
Sequence:CCGGCAGAGCCTTGTTATTATTCTTCTCGAGAAGAATAATAACAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-216s1c1
Sequence:CCGGCCAGACTGGATACTTCTATTTCTCGAGAAATAGAAGTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-345s1c1
Sequence:CCGGCCAGATTAACTTCTCTACCCACTCGAGTGGGTAGAGAAGTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-153s1c1
Sequence:CCGGTCGATATGACTTTGCCATCATCTCGAGATGATGGCAAAGTCATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-632s21c1
Sequence:CCGCCCTTATCCAATCAAACTATAACTCGAGTTATAGTTTGATTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-445s21c1
Sequence:CCGGTGCAAGTGTACCTCAACTTTGCTCGAGCAAAGTTGAGGTACACTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-411s21c1
Sequence:CCGGTGTCTAAGTAATCAGCATAATCTCGAGATTATGCTGATTACTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-775s21c1
Sequence:CCGGGCTAAGCTAAGGTGACTATAGCTCGAGCTATAGTCACCTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144676
TMED6 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-540s1c1
Sequence:CCGGGCAGAACAATATCTTTCACATCTCGAGATGTGAAAGATATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-655s1c1
Sequence:CCGGCAGAGCCTTGTTATTATTCTTCTCGAGAAGAATAATAACAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-216s1c1
Sequence:CCGGCCAGACTGGATACTTCTATTTCTCGAGAAATAGAAGTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-345s1c1
Sequence:CCGGCCAGATTAACTTCTCTACCCACTCGAGTGGGTAGAGAAGTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-153s1c1
Sequence:CCGGTCGATATGACTTTGCCATCATCTCGAGATGATGGCAAAGTCATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-632s21c1
Sequence:CCGCCCTTATCCAATCAAACTATAACTCGAGTTATAGTTTGATTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-445s21c1
Sequence:CCGGTGCAAGTGTACCTCAACTTTGCTCGAGCAAAGTTGAGGTACACTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-411s21c1
Sequence:CCGGTGTCTAAGTAATCAGCATAATCTCGAGATTATGCTGATTACTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-775s21c1
Sequence:CCGGGCTAAGCTAAGGTGACTATAGCTCGAGCTATAGTCACCTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144676
TMED6 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-540s1c1
Sequence:CCGGGCAGAACAATATCTTTCACATCTCGAGATGTGAAAGATATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-655s1c1
Sequence:CCGGCAGAGCCTTGTTATTATTCTTCTCGAGAAGAATAATAACAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-216s1c1
Sequence:CCGGCCAGACTGGATACTTCTATTTCTCGAGAAATAGAAGTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-345s1c1
Sequence:CCGGCCAGATTAACTTCTCTACCCACTCGAGTGGGTAGAGAAGTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144676.1-153s1c1
Sequence:CCGGTCGATATGACTTTGCCATCATCTCGAGATGATGGCAAAGTCATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-632s21c1
Sequence:CCGCCCTTATCCAATCAAACTATAACTCGAGTTATAGTTTGATTGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-445s21c1
Sequence:CCGGTGCAAGTGTACCTCAACTTTGCTCGAGCAAAGTTGAGGTACACTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-411s21c1
Sequence:CCGGTGTCTAAGTAATCAGCATAATCTCGAGATTATGCTGATTACTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144676.3-775s21c1
Sequence:CCGGGCTAAGCTAAGGTGACTATAGCTCGAGCTATAGTCACCTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks