EMAIL THIS PAGE TO A FRIEND

TMED7

transmembrane emp24 protein transport domain containing 7

Synonyms: p27
UniProtKB ID: Q9Y3B3, Q8NBU8, Q8WUU6, Q96K51
Gene ID:
Mouse(66676) transmembrane emp24 protein transport domain containing 7
Rat(252889) transmembrane emp24 protein transport domain containing 7
cow(100125926) transmembrane emp24 protein transport domain containing 7
naked mole-rat(101722352) transmembrane emp24 protein transport domain containing 7
Domestic Rabbit(100533192) transmembrane emp24 protein transport domain containing 7
domestic guinea pig(100719150) transmembrane emp24 protein transport domain containing 7
Zebrafish(405848) transmembrane emp24 protein transport domain containing 7
chicken(769360) transmembrane emp24 protein transport domain containing 7
Horse(100529263) transmembrane emp24 protein transport domain containing 7
domestic cat(101100690) transmembrane emp24 protein transport domain containing 7
dog(481436) transmembrane emp24 protein transport domain containing 7
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181836 Rosetta Predictions human pricing
NM_001105758 Rosetta Predictions rat pricing
XM_128959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370423 predicted 338
2 SASI_Hs01_00040827 predicted 399
3 SASI_Hs01_00040828 predicted 442
4 SASI_Hs02_00370424 predicted 414
5 SASI_Hs01_00040829 predicted 312
6 SASI_Hs01_00040830 predicted 412
7 SASI_Hs01_00040832 predicted 448
8 SASI_Hs01_00040833 predicted 368
9 SASI_Hs01_00040834 predicted 398
10 SASI_Hs01_00040835 predicted 385
11 SASI_Hs01_00040831 predicted 317
12 SASI_Hs01_00040836 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212236 predicted 673
2 SASI_Rn02_00212237 predicted 472
3 SASI_Rn02_00212238 predicted 727
4 SASI_Rn02_00212239 predicted 947
5 SASI_Rn02_00212240 predicted 609
6 SASI_Rn02_00212241 predicted 893
7 SASI_Rn02_00212242 predicted 731
8 SASI_Rn02_00212243 predicted 929
9 SASI_Rn02_00212244 predicted 975
10 SASI_Rn02_00212245 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280178 predicted 1084
2 SASI_Mm01_00280179 predicted 998
3 SASI_Mm01_00280180 predicted 1089
4 SASI_Mm01_00280181 predicted 856
5 SASI_Mm01_00280182 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181836
VALIDATED
TMED7 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1325s21c1
Sequence:CCGGATCTACTCTTCGCACACTAAACTCGAGTTTAGTGTGCGAAGAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181836.5-985s21c1
Sequence:CCGGGTTAGCATAGGGCAGGTATTTCTCGAGAAATACCTGCCCTATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1303s21c1
Sequence:CCGGTACTCTGTTCGCAGTTGTTTACTCGAGTAAACAACTGCGAACAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-655s1c1
Sequence:CCGGGCCTGTGTTTCAATTCACGAACTCGAGTTCGTGAATTGAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-860s1c1
Sequence:CCGGCCACAACTCGTGTTGGATCATCTCGAGATGATCCAACACGAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-672s1c1
Sequence:CCGGCGAAGCTCTGAAGTCTGTCATCTCGAGATGACAGACTTCAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-737s1c1
Sequence:CCGGGCCGAGCAGAGGATCTAAATACTCGAGTATTTAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181836.3-410s1c1
Sequence:CCGGGTGGTCACTATGATGTAGATTCTCGAGAATCTACATCATAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181836
VALIDATED
TMED7 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1325s21c1
Sequence:CCGGATCTACTCTTCGCACACTAAACTCGAGTTTAGTGTGCGAAGAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181836.5-985s21c1
Sequence:CCGGGTTAGCATAGGGCAGGTATTTCTCGAGAAATACCTGCCCTATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1303s21c1
Sequence:CCGGTACTCTGTTCGCAGTTGTTTACTCGAGTAAACAACTGCGAACAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-655s1c1
Sequence:CCGGGCCTGTGTTTCAATTCACGAACTCGAGTTCGTGAATTGAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-860s1c1
Sequence:CCGGCCACAACTCGTGTTGGATCATCTCGAGATGATCCAACACGAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-672s1c1
Sequence:CCGGCGAAGCTCTGAAGTCTGTCATCTCGAGATGACAGACTTCAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-737s1c1
Sequence:CCGGGCCGAGCAGAGGATCTAAATACTCGAGTATTTAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181836.3-410s1c1
Sequence:CCGGGTGGTCACTATGATGTAGATTCTCGAGAATCTACATCATAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181836
VALIDATED
TMED7 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1325s21c1
Sequence:CCGGATCTACTCTTCGCACACTAAACTCGAGTTTAGTGTGCGAAGAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181836.5-985s21c1
Sequence:CCGGGTTAGCATAGGGCAGGTATTTCTCGAGAAATACCTGCCCTATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181836.5-1303s21c1
Sequence:CCGGTACTCTGTTCGCAGTTGTTTACTCGAGTAAACAACTGCGAACAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-655s1c1
Sequence:CCGGGCCTGTGTTTCAATTCACGAACTCGAGTTCGTGAATTGAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-860s1c1
Sequence:CCGGCCACAACTCGTGTTGGATCATCTCGAGATGATCCAACACGAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-672s1c1
Sequence:CCGGCGAAGCTCTGAAGTCTGTCATCTCGAGATGACAGACTTCAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181836.3-737s1c1
Sequence:CCGGGCCGAGCAGAGGATCTAAATACTCGAGTATTTAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181836.3-410s1c1
Sequence:CCGGGTGGTCACTATGATGTAGATTCTCGAGAATCTACATCATAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025698
VALIDATED
TMED7 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-736s21c1
Sequence:CCGGCATTGACTATCAGACACATTTCTCGAGAAATGTGTCTGATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-1166s21c1
Sequence:CCGGATGTACTCTTCCTACACTAACCTCGAGGTTAGTGTAGGAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-783s21c1
Sequence:CCGGGCCGAGCAGAGGATCTGAATACTCGAGTATTCAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-365s21c1
Sequence:CCGGACCTTCGAGCTGCCCGATAATCTCGAGATTATCGGGCAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-542s21c1
Sequence:CCGGACCTTCACAGCCTCCAGAAATCTCGAGATTTCTGGAGGCTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025698
VALIDATED
TMED7 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-736s21c1
Sequence:CCGGCATTGACTATCAGACACATTTCTCGAGAAATGTGTCTGATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-1166s21c1
Sequence:CCGGATGTACTCTTCCTACACTAACCTCGAGGTTAGTGTAGGAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-783s21c1
Sequence:CCGGGCCGAGCAGAGGATCTGAATACTCGAGTATTCAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-365s21c1
Sequence:CCGGACCTTCGAGCTGCCCGATAATCTCGAGATTATCGGGCAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-542s21c1
Sequence:CCGGACCTTCACAGCCTCCAGAAATCTCGAGATTTCTGGAGGCTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025698
VALIDATED
TMED7 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-736s21c1
Sequence:CCGGCATTGACTATCAGACACATTTCTCGAGAAATGTGTCTGATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-1166s21c1
Sequence:CCGGATGTACTCTTCCTACACTAACCTCGAGGTTAGTGTAGGAAGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-783s21c1
Sequence:CCGGGCCGAGCAGAGGATCTGAATACTCGAGTATTCAGATCCTCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-365s21c1
Sequence:CCGGACCTTCGAGCTGCCCGATAATCTCGAGATTATCGGGCAGCTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025698.1-542s21c1
Sequence:CCGGACCTTCACAGCCTCCAGAAATCTCGAGATTTCTGGAGGCTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks