EMAIL THIS PAGE TO A FRIEND

TMED8

transmembrane emp24 protein transport domain containing 8

Synonyms: FAM15B
UniProtKB ID: Q6PL24, B3KTI6, Q3MJB0, Q9P1V9
Gene ID:
Mouse(382620) transmembrane emp24 domain containing 8
Zebrafish(553196) transmembrane emp24 protein transport domain containing 8
chicken(423375) transmembrane emp24 protein transport domain containing 8
dog(490807) transmembrane emp24 protein transport domain containing 8
domestic cat(101085552) transmembrane emp24 protein transport domain containing 8
domestic guinea pig(100726950) transmembrane emp24 protein transport domain containing 8
naked mole-rat(101704736) transmembrane emp24 protein transport domain containing 8
cow(614106) transmembrane emp24 protein transport domain containing 8
sheep(101110337) transmembrane emp24 protein transport domain containing 8
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001205 Anti-TMED8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103952 Anti-TMED8 antibody produced in rabbit affinity isolated antibody guinea pig, rat, rabbit, horse, mouse, bovine, human
western blot pricing
SAB2104104 Anti-TMED8 antibody produced in rabbit affinity isolated antibody bovine, rat, horse, zebrafish, mouse, human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213601 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213601 Rosetta Predictions human pricing
NM_001033475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161265 predicted 612
2 SASI_Hs01_00161266 predicted 494
3 SASI_Hs02_00374280 predicted 229
4 SASI_Hs01_00161267 predicted 312
5 SASI_Hs01_00161268 predicted 611
6 SASI_Hs01_00161269 predicted 371
7 SASI_Hs01_00161270 predicted 570
8 SASI_Hs01_00161272 predicted 320
9 SASI_Hs01_00161273 predicted 675
10 SASI_Hs01_00161274 predicted 628
11 SASI_Hs01_00161271 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057088 predicted 266
2 SASI_Mm01_00057089 predicted 1326
3 SASI_Mm01_00057090 predicted 387
4 SASI_Mm01_00057091 predicted 1348
5 SASI_Mm01_00057092 predicted 1274
6 SASI_Mm01_00057093 predicted 1349
7 SASI_Mm01_00057094 predicted 1203
8 SASI_Mm01_00057095 predicted 1109
9 SASI_Mm01_00057096 predicted 1427
10 SASI_Mm02_00288837 predicted 240
11 SASI_Mm01_00057087 predicted 1061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213601
TMED8 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-672s1c1
Sequence:CCGGCCCTGTAACTAGCACTGACATCTCGAGATGTCAGTGCTAGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-625s1c1
Sequence:CCGGGCGACCGATGACTATGACATTCTCGAGAATGTCATAGTCATCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-496s1c1
Sequence:CCGGGCCAAGGTGAAGGAATTCAAACTCGAGTTTGAATTCCTTCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-112s1c1
Sequence:CCGGGCCTCAGAGAATGAAGATCTACTCGAGTAGATCTTCATTCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-318s1c1
Sequence:CCGGCCTCAATGAGATGGCTAAGTACTCGAGTACTTAGCCATCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-706s21c1
Sequence:CCGGAGTGATTCCAGTGACGATGAGCTCGAGCTCATCGTCACTGGAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-364s21c1
Sequence:CCGGATCGTTATGATCCAGTCTGAACTCGAGTTCAGACTGGATCATAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-243s21c1
Sequence:CCGGGCGGAAAGCAACTGGTCCTTTCTCGAGAAAGGACCAGTTGCTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-193s21c1
Sequence:CCGGCACAGGCCACAGATGGTATCTCTCGAGAGATACCATCTGTGGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-400s21c1
Sequence:CCGGGATGTTCTTTCAGCTGATTTGCTCGAGCAAATCAGCTGAAAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213601
TMED8 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-672s1c1
Sequence:CCGGCCCTGTAACTAGCACTGACATCTCGAGATGTCAGTGCTAGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-625s1c1
Sequence:CCGGGCGACCGATGACTATGACATTCTCGAGAATGTCATAGTCATCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-496s1c1
Sequence:CCGGGCCAAGGTGAAGGAATTCAAACTCGAGTTTGAATTCCTTCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-112s1c1
Sequence:CCGGGCCTCAGAGAATGAAGATCTACTCGAGTAGATCTTCATTCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-318s1c1
Sequence:CCGGCCTCAATGAGATGGCTAAGTACTCGAGTACTTAGCCATCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-706s21c1
Sequence:CCGGAGTGATTCCAGTGACGATGAGCTCGAGCTCATCGTCACTGGAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-364s21c1
Sequence:CCGGATCGTTATGATCCAGTCTGAACTCGAGTTCAGACTGGATCATAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-243s21c1
Sequence:CCGGGCGGAAAGCAACTGGTCCTTTCTCGAGAAAGGACCAGTTGCTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-193s21c1
Sequence:CCGGCACAGGCCACAGATGGTATCTCTCGAGAGATACCATCTGTGGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-400s21c1
Sequence:CCGGGATGTTCTTTCAGCTGATTTGCTCGAGCAAATCAGCTGAAAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213601
TMED8 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-672s1c1
Sequence:CCGGCCCTGTAACTAGCACTGACATCTCGAGATGTCAGTGCTAGTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-625s1c1
Sequence:CCGGGCGACCGATGACTATGACATTCTCGAGAATGTCATAGTCATCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-496s1c1
Sequence:CCGGGCCAAGGTGAAGGAATTCAAACTCGAGTTTGAATTCCTTCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-112s1c1
Sequence:CCGGGCCTCAGAGAATGAAGATCTACTCGAGTAGATCTTCATTCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213601.1-318s1c1
Sequence:CCGGCCTCAATGAGATGGCTAAGTACTCGAGTACTTAGCCATCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-706s21c1
Sequence:CCGGAGTGATTCCAGTGACGATGAGCTCGAGCTCATCGTCACTGGAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-364s21c1
Sequence:CCGGATCGTTATGATCCAGTCTGAACTCGAGTTCAGACTGGATCATAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-243s21c1
Sequence:CCGGGCGGAAAGCAACTGGTCCTTTCTCGAGAAAGGACCAGTTGCTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-193s21c1
Sequence:CCGGCACAGGCCACAGATGGTATCTCTCGAGAGATACCATCTGTGGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213601.1-400s21c1
Sequence:CCGGGATGTTCTTTCAGCTGATTTGCTCGAGCAAATCAGCTGAAAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033475
TMED8 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-979s21c1
Sequence:CCGGTCTACTTCCATATCTACTATACTCGAGTATAGTAGATATGGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-234s21c1
Sequence:CCGGATGGTATCTCCAGCGAGTAAGCTCGAGCTTACTCGCTGGAGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-704s21c1
Sequence:CCGGAGTAACCAGCACTGATATAACCTCGAGGTTATATCAGTGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033475.3-4470s21c1
Sequence:CCGGATTGAGTGACCCTAGTAATTACTCGAGTAATTACTAGGGTCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-894s21c1
Sequence:CCGGCAAGCTGGCAGCCATGATTACCTCGAGGTAATCATGGCTGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033475
TMED8 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-979s21c1
Sequence:CCGGTCTACTTCCATATCTACTATACTCGAGTATAGTAGATATGGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-234s21c1
Sequence:CCGGATGGTATCTCCAGCGAGTAAGCTCGAGCTTACTCGCTGGAGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-704s21c1
Sequence:CCGGAGTAACCAGCACTGATATAACCTCGAGGTTATATCAGTGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033475.3-4470s21c1
Sequence:CCGGATTGAGTGACCCTAGTAATTACTCGAGTAATTACTAGGGTCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-894s21c1
Sequence:CCGGCAAGCTGGCAGCCATGATTACCTCGAGGTAATCATGGCTGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033475
TMED8 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-979s21c1
Sequence:CCGGTCTACTTCCATATCTACTATACTCGAGTATAGTAGATATGGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-234s21c1
Sequence:CCGGATGGTATCTCCAGCGAGTAAGCTCGAGCTTACTCGCTGGAGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-704s21c1
Sequence:CCGGAGTAACCAGCACTGATATAACCTCGAGGTTATATCAGTGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033475.3-4470s21c1
Sequence:CCGGATTGAGTGACCCTAGTAATTACTCGAGTAATTACTAGGGTCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033475.3-894s21c1
Sequence:CCGGCAAGCTGGCAGCCATGATTACCTCGAGGTAATCATGGCTGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks