EMAIL THIS PAGE TO A FRIEND

TMED9

transmembrane emp24 protein transport domain containing 9

Synonyms: GMP25 HSGP25L2G p25
UniProtKB ID: Q9BVK6, Q14437, Q8WZ61
Gene ID:
Mouse(67511) transmembrane emp24 protein transport domain containing 9
Rat(361207) transmembrane emp24 protein transport domain containing 9
cow(618580) transmembrane emp24 protein transport domain containing 9
sheep(101102809) transmembrane emp24 protein transport domain containing 9
naked mole-rat(101713382) transmembrane emp24 protein transport domain containing 9
domestic guinea pig(100714314) transmembrane emp24 protein transport domain containing 9
Zebrafish(613145) transmembrane emp24 protein transport domain containing 9
dog(481444) transmembrane emp24 protein transport domain containing 9
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017510 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075051 MISSION® esiRNA esiRNA targeting mouse Tmed9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017510 Rosetta Predictions human pricing
NM_001009703 Rosetta Predictions rat pricing
NM_026211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185019 predicted 431
2 SASI_Hs01_00185021 predicted 692
3 SASI_Hs01_00185022 predicted 792
4 SASI_Hs01_00185023 predicted 701
5 SASI_Hs01_00185024 predicted 742
6 SASI_Hs01_00185025 predicted 759
7 SASI_Hs01_00185027 predicted 556
8 SASI_Hs02_00350122 predicted 431
9 SASI_Hs01_00185018 predicted 284
10 SASI_Hs01_00185020 predicted 505
11 SASI_Hs01_00185026 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033621 predicted 1164
2 SASI_Rn01_00033622 predicted 965
3 SASI_Rn01_00033623 predicted 251
4 SASI_Rn01_00033624 predicted 692
5 SASI_Rn02_00199765 predicted 476
6 SASI_Rn01_00033626 predicted 461
7 SASI_Rn01_00033627 predicted 435
8 SASI_Rn02_00199766 predicted 796
9 SASI_Rn01_00033628 predicted 360
10 SASI_Rn01_00033629 predicted 347
11 SASI_Rn01_00033625 predicted 774
12 SASI_Rn01_00033630 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124029 predicted 1133
2 SASI_Mm01_00124030 predicted 598
3 SASI_Mm01_00124031 predicted 990
4 SASI_Mm01_00124032 predicted 320
5 SASI_Mm01_00124033 predicted 1184
6 SASI_Mm01_00124034 predicted 895
7 SASI_Mm01_00124035 predicted 1196
8 SASI_Mm01_00124037 predicted 281
9 SASI_Mm02_00329879 predicted 1092
10 SASI_Mm01_00124038 predicted 469
11 SASI_Mm01_00124036 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026211
VALIDATED
TMED9 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-151s21c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-481s21c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026211.3-1082s21c1
Sequence:CCGGCCTTCTGTCTTCCTTTGTTAACTCGAGTTAACAAAGGAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-611s21c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-477s1c1
Sequence:CCGGGCAAACGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-474s1c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-144s1c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-604s1c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026211
VALIDATED
TMED9 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-151s21c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-481s21c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026211.3-1082s21c1
Sequence:CCGGCCTTCTGTCTTCCTTTGTTAACTCGAGTTAACAAAGGAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-611s21c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-477s1c1
Sequence:CCGGGCAAACGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-474s1c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-144s1c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-604s1c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026211
VALIDATED
TMED9 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-151s21c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-481s21c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026211.3-1082s21c1
Sequence:CCGGCCTTCTGTCTTCCTTTGTTAACTCGAGTTAACAAAGGAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026211.3-611s21c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-477s1c1
Sequence:CCGGGCAAACGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-474s1c1
Sequence:CCGGCATGCAAACGACTATGCAGAACTCGAGTTCTGCATAGTCGTTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-144s1c1
Sequence:CCGGCTGTATTTCCACATCGGAGAACTCGAGTTCTCCGATGTGGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026211.1-604s1c1
Sequence:CCGGGCTTCAGACAAACCAGCGAAACTCGAGTTTCGCTGGTTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017510
VALIDATED
TMED9 MISSION shRNA Bacterial Glycerol Stock
transmembrane emp24 protein transport domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-448s21c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017510.4-1049s21c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-469s21c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-670s21c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-144s21c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017510.3-670s1c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-448s1c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-144s1c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017510.3-1049s1c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-469s1c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017510
VALIDATED
TMED9 MISSION shRNA shRNA Plasmid DNA
transmembrane emp24 protein transport domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-448s21c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017510.4-1049s21c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-469s21c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-670s21c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-144s21c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017510.3-670s1c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-448s1c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-144s1c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017510.3-1049s1c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-469s1c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017510
VALIDATED
TMED9 MISSION shRNA Lentiviral Transduction Particles
transmembrane emp24 protein transport domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-448s21c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017510.4-1049s21c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-469s21c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-670s21c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017510.4-144s21c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017510.3-670s1c1
Sequence:CCGGCGGCACCTCAAGAGCTTCTTTCTCGAGAAAGAAGCTCTTGAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-448s1c1
Sequence:CCGGGCCAATGACTATGCAGAAATTCTCGAGAATTTCTGCATAGTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-144s1c1
Sequence:CCGGGAAGTGCTTTATTGAGGAGATCTCGAGATCTCCTCAATAAAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017510.3-1049s1c1
Sequence:CCGGGCCAGTCTTCTGTCTTCCTTTCTCGAGAAAGGAAGACAGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017510.3-469s1c1
Sequence:CCGGGCTGCTAAAGACAAGTTGAGTCTCGAGACTCAACTTGTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks