EMAIL THIS PAGE TO A FRIEND

TMEFF1

transmembrane protein with EGF-like and two follistatin-like domains 1

Synonyms: C9orf2 CT120.1 H7365 TR-1
UniProtKB ID: Q8IYR6, Q13086, Q8N3T8
Gene ID:
Mouse(230157) transmembrane protein with EGF-like and two follistatin-like domains 1
Rat(63845) transmembrane protein with EGF-like and two follistatin-like domains 1
chicken(420985) transmembrane protein with EGF-like and two follistatin-like domains 1
dog(612942) UPF0439 protein C9orf30-like
domestic cat(101085756) transmembrane protein with EGF-like and two follistatin-like domains 1
naked mole-rat(101710773) transmembrane protein with EGF-like and two follistatin-like domains 1
cow(100139803) transmembrane protein with EGF-like and two follistatin-like domains 1
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003692 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081111 MISSION® esiRNA esiRNA targeting mouse Tmeff1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003692 Rosetta Predictions human pricing
NM_023020 Rosetta Predictions rat pricing
NM_021436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170483 predicted 498
2 SASI_Hs01_00170484 predicted 1092
3 SASI_Hs01_00170485 predicted 337
4 SASI_Hs01_00170486 predicted 1135
5 SASI_Hs01_00170487 predicted 845
6 SASI_Hs01_00170488 predicted 333
7 SASI_Hs01_00170489 predicted 320
8 SASI_Hs01_00170490 predicted 940
9 SASI_Hs01_00170491 predicted 1080
10 SASI_Hs01_00170492 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030948 predicted 628
2 SASI_Rn01_00030949 predicted 473
3 SASI_Rn01_00030952 predicted 508
4 SASI_Rn02_00263702 predicted 1316
5 SASI_Rn01_00030955 predicted 1070
6 SASI_Rn02_00263703 predicted 1222
7 SASI_Rn02_00263704 predicted 475
8 SASI_Rn02_00263705 predicted 1298
9 SASI_Rn02_00263706 predicted 1225
10 SASI_Rn01_00030956 predicted 1053
11 SASI_Rn01_00030950 predicted 863
12 SASI_Rn01_00030951 predicted 335
13 SASI_Rn01_00030953 predicted 263
14 SASI_Rn01_00030954 predicted 841
15 SASI_Rn01_00030957 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137901 predicted 999
2 SASI_Mm01_00137902 predicted 970
3 SASI_Mm01_00137903 predicted 1184
4 SASI_Mm01_00137904 predicted 1044
5 SASI_Mm01_00137905 predicted 441
6 SASI_Mm01_00137906 predicted 1425
7 SASI_Mm01_00137907 predicted 1228
8 SASI_Mm01_00137908 predicted 800
9 SASI_Mm01_00137909 predicted 480
10 SASI_Mm01_00137910 predicted 1246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021436
TMEFF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein with EGF-like and two follistatin-like domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021436.1-1725s1c1
Sequence:CCGGCCACAGCAAATGACAAAGCATCTCGAGATGCTTTGTCATTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-908s1c1
Sequence:CCGGGCGTCGTGTATAAAGCAAGAACTCGAGTTCTTGCTTTATACACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1265s1c1
Sequence:CCGGGCAGTACAGATCGCCATTATACTCGAGTATAATGGCGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1237s1c1
Sequence:CCGGCCATGTTCTTATCGCAGCCATCTCGAGATGGCTGCGATAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-549s1c1
Sequence:CCGGGCCAGTTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021436
TMEFF1 MISSION shRNA shRNA Plasmid DNA
transmembrane protein with EGF-like and two follistatin-like domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021436.1-1725s1c1
Sequence:CCGGCCACAGCAAATGACAAAGCATCTCGAGATGCTTTGTCATTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-908s1c1
Sequence:CCGGGCGTCGTGTATAAAGCAAGAACTCGAGTTCTTGCTTTATACACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1265s1c1
Sequence:CCGGGCAGTACAGATCGCCATTATACTCGAGTATAATGGCGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1237s1c1
Sequence:CCGGCCATGTTCTTATCGCAGCCATCTCGAGATGGCTGCGATAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-549s1c1
Sequence:CCGGGCCAGTTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021436
TMEFF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein with EGF-like and two follistatin-like domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021436.1-1725s1c1
Sequence:CCGGCCACAGCAAATGACAAAGCATCTCGAGATGCTTTGTCATTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-908s1c1
Sequence:CCGGGCGTCGTGTATAAAGCAAGAACTCGAGTTCTTGCTTTATACACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1265s1c1
Sequence:CCGGGCAGTACAGATCGCCATTATACTCGAGTATAATGGCGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-1237s1c1
Sequence:CCGGCCATGTTCTTATCGCAGCCATCTCGAGATGGCTGCGATAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021436.1-549s1c1
Sequence:CCGGGCCAGTTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003692
VALIDATED
TMEFF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein with EGF-like and two follistatin-like domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-1094s1c1
Sequence:CCGGCATGTTCTTATTGCAGCAATTCTCGAGAATTGCTGCAATAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-405s1c1
Sequence:CCGGGCCAATTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-402s1c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-488s1c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003692.2-1736s1c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-293s21c1
Sequence:CCGGCATCAACTGCTCAGAATTAAACTCGAGTTTAATTCTGAGCAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-403s21c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1234s21c1
Sequence:CCGGCGTCATCCAGAATGGTTTAAACTCGAGTTTAAACCATTCTGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-489s21c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1738s21c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003692
VALIDATED
TMEFF1 MISSION shRNA shRNA Plasmid DNA
transmembrane protein with EGF-like and two follistatin-like domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-1094s1c1
Sequence:CCGGCATGTTCTTATTGCAGCAATTCTCGAGAATTGCTGCAATAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-405s1c1
Sequence:CCGGGCCAATTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-402s1c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-488s1c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003692.2-1736s1c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-293s21c1
Sequence:CCGGCATCAACTGCTCAGAATTAAACTCGAGTTTAATTCTGAGCAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-403s21c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1234s21c1
Sequence:CCGGCGTCATCCAGAATGGTTTAAACTCGAGTTTAAACCATTCTGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-489s21c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1738s21c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003692
VALIDATED
TMEFF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein with EGF-like and two follistatin-like domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-1094s1c1
Sequence:CCGGCATGTTCTTATTGCAGCAATTCTCGAGAATTGCTGCAATAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-405s1c1
Sequence:CCGGGCCAATTTCAGTGCCATACAACTCGAGTTGTATGGCACTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-402s1c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003692.2-488s1c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003692.2-1736s1c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-293s21c1
Sequence:CCGGCATCAACTGCTCAGAATTAAACTCGAGTTTAATTCTGAGCAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-403s21c1
Sequence:CCGGCATGCCAATTTCAGTGCCATACTCGAGTATGGCACTGAAATTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1234s21c1
Sequence:CCGGCGTCATCCAGAATGGTTTAAACTCGAGTTTAAACCATTCTGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-489s21c1
Sequence:CCGGGCTGCTTGTAAGCACCAGAAACTCGAGTTTCTGGTGCTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003692.3-1738s21c1
Sequence:CCGGGCTGTGTGTATTAGGTGTAAACTCGAGTTTACACCTAATACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks