EMAIL THIS PAGE TO A FRIEND

TMEFF2

transmembrane protein with EGF-like and two follistatin-like domains 2

Synonyms: CT120.2 HPP1 TENB2 TPEF TR
Gene ID:
Mouse(56363) transmembrane protein with EGF-like and two follistatin-like domains 2
Rat(363228) transmembrane protein with EGF-like and two follistatin-like domains 2
chicken(768542) transmembrane protein with EGF-like and two follistatin-like domains 2
domestic cat(101085308) transmembrane protein with EGF-like and two follistatin-like domains 2
Horse(100054833) transmembrane protein with EGF-like and two follistatin-like domains 2
dog(478848) transmembrane protein with EGF-like and two follistatin-like domains 2
cow(538354) transmembrane protein with EGF-like and two follistatin-like domains 2
sheep(101118760) transmembrane protein with EGF-like and two follistatin-like domains 2
naked mole-rat(101717076) transmembrane protein with EGF-like and two follistatin-like domains 2
Domestic Rabbit(100345498) transmembrane protein with EGF-like and two follistatin-like domains 2
domestic guinea pig(100714257) transmembrane protein with EGF-like and two follistatin-like domains 2
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119081 MISSION® esiRNA esiRNA human TMEFF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016192 Rosetta Predictions human pricing
NM_001108795 Rosetta Predictions rat pricing
NM_019790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183360 predicted 551
2 SASI_Hs01_00183361 predicted 1320
3 SASI_Hs01_00183362 predicted 1178
4 SASI_Hs02_00349022 predicted 1441
5 SASI_Hs01_00183363 predicted 1000
6 SASI_Hs01_00183364 predicted 1556
7 SASI_Hs01_00183365 predicted 723
8 SASI_Hs01_00183366 predicted 1465
9 SASI_Hs01_00183367 predicted 884
10 SASI_Hs01_00183368 predicted 1359
11 SASI_Hs01_00183369 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242145 predicted 626
2 SASI_Rn02_00242146 predicted 983
3 SASI_Rn02_00242147 predicted 1176
4 SASI_Rn02_00242148 predicted 1320
5 SASI_Rn02_00242149 predicted 1271
6 SASI_Rn02_00242150 predicted 760
7 SASI_Rn02_00242151 predicted 1033
8 SASI_Rn02_00242152 predicted 1019
9 SASI_Rn02_00242153 predicted 787
10 SASI_Rn02_00242154 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147342 predicted 1216
2 SASI_Mm01_00147343 predicted 1253
3 SASI_Mm02_00325007 predicted 1494
4 SASI_Mm01_00147345 predicted 1297
5 SASI_Mm01_00147346 predicted 1568
6 SASI_Mm01_00147347 predicted 1013
7 SASI_Mm01_00147348 predicted 1336
8 SASI_Mm01_00147349 predicted 1396
9 SASI_Mm01_00147350 predicted 1619
10 SASI_Mm01_00147351 predicted 1398
11 SASI_Mm01_00147344 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016192
VALIDATED
TMEFF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein with EGF-like and two follistatin-like domains 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1134s21c1
Sequence:CCGGATGCAGAGAATGCTAACAAATCTCGAGATTTGTTAGCATTCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1180s21c1
Sequence:CCGGCATACCTTGTCCGGAACATTACTCGAGTAATGTTCCGGACAAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1496s21c1
Sequence:CCGGAGAGCGTCCACGAGGTTAATCCTCGAGGATTAACCTCGTGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-661s1c2
Sequence:CCGGCGTCTGTCAGTTCAAGTGCAACTCGAGTTGCACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1260s1c1
Sequence:CCGGGCAGGTGTGATGCTGGTTATACTCGAGTATAACCAGCATCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-564s1c1
Sequence:CCGGCTGGTTATGATGACAGAGAAACTCGAGTTTCTCTGTCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-978s1c1
Sequence:CCGGGCGCTTCTGATGGGAAATCTTCTCGAGAAGATTTCCCATCAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1617s1c1
Sequence:CCGGCCTTGCATTTGTGGTAATCTACTCGAGTAGATTACCACAAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016192
VALIDATED
TMEFF2 MISSION shRNA shRNA Plasmid DNA
transmembrane protein with EGF-like and two follistatin-like domains 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1134s21c1
Sequence:CCGGATGCAGAGAATGCTAACAAATCTCGAGATTTGTTAGCATTCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1180s21c1
Sequence:CCGGCATACCTTGTCCGGAACATTACTCGAGTAATGTTCCGGACAAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1496s21c1
Sequence:CCGGAGAGCGTCCACGAGGTTAATCCTCGAGGATTAACCTCGTGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-661s1c2
Sequence:CCGGCGTCTGTCAGTTCAAGTGCAACTCGAGTTGCACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1260s1c1
Sequence:CCGGGCAGGTGTGATGCTGGTTATACTCGAGTATAACCAGCATCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-564s1c1
Sequence:CCGGCTGGTTATGATGACAGAGAAACTCGAGTTTCTCTGTCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-978s1c1
Sequence:CCGGGCGCTTCTGATGGGAAATCTTCTCGAGAAGATTTCCCATCAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1617s1c1
Sequence:CCGGCCTTGCATTTGTGGTAATCTACTCGAGTAGATTACCACAAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016192
VALIDATED
TMEFF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein with EGF-like and two follistatin-like domains 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1134s21c1
Sequence:CCGGATGCAGAGAATGCTAACAAATCTCGAGATTTGTTAGCATTCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1180s21c1
Sequence:CCGGCATACCTTGTCCGGAACATTACTCGAGTAATGTTCCGGACAAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016192.2-1496s21c1
Sequence:CCGGAGAGCGTCCACGAGGTTAATCCTCGAGGATTAACCTCGTGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-661s1c2
Sequence:CCGGCGTCTGTCAGTTCAAGTGCAACTCGAGTTGCACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1260s1c1
Sequence:CCGGGCAGGTGTGATGCTGGTTATACTCGAGTATAACCAGCATCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-564s1c1
Sequence:CCGGCTGGTTATGATGACAGAGAAACTCGAGTTTCTCTGTCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-978s1c1
Sequence:CCGGGCGCTTCTGATGGGAAATCTTCTCGAGAAGATTTCCCATCAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016192.2-1617s1c1
Sequence:CCGGCCTTGCATTTGTGGTAATCTACTCGAGTAGATTACCACAAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019790
TMEFF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein with EGF-like and two follistatin-like domains 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019790.2-2841s1c1
Sequence:CCGGCCTCCTTTGTTAGAAACCAAACTCGAGTTTGGTTTCTAACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1371s1c1
Sequence:CCGGCGGTTCCAGTACGTCTTGATTCTCGAGAATCAAGACGTACTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1220s1c1
Sequence:CCGGCCCAGAACATTATAATGGTTTCTCGAGAAACCATTATAATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-595s1c1
Sequence:CCGGCCGGTTACGATGACAGAGAAACTCGAGTTTCTCTGTCATCGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-692s1c1
Sequence:CCGGCGTCTGTCAGTTCAAGTGTAACTCGAGTTACACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019790
TMEFF2 MISSION shRNA shRNA Plasmid DNA
transmembrane protein with EGF-like and two follistatin-like domains 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019790.2-2841s1c1
Sequence:CCGGCCTCCTTTGTTAGAAACCAAACTCGAGTTTGGTTTCTAACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1371s1c1
Sequence:CCGGCGGTTCCAGTACGTCTTGATTCTCGAGAATCAAGACGTACTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1220s1c1
Sequence:CCGGCCCAGAACATTATAATGGTTTCTCGAGAAACCATTATAATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-595s1c1
Sequence:CCGGCCGGTTACGATGACAGAGAAACTCGAGTTTCTCTGTCATCGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-692s1c1
Sequence:CCGGCGTCTGTCAGTTCAAGTGTAACTCGAGTTACACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019790
TMEFF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein with EGF-like and two follistatin-like domains 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019790.2-2841s1c1
Sequence:CCGGCCTCCTTTGTTAGAAACCAAACTCGAGTTTGGTTTCTAACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1371s1c1
Sequence:CCGGCGGTTCCAGTACGTCTTGATTCTCGAGAATCAAGACGTACTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-1220s1c1
Sequence:CCGGCCCAGAACATTATAATGGTTTCTCGAGAAACCATTATAATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-595s1c1
Sequence:CCGGCCGGTTACGATGACAGAGAAACTCGAGTTTCTCTGTCATCGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019790.2-692s1c1
Sequence:CCGGCGTCTGTCAGTTCAAGTGTAACTCGAGTTACACTTGAACTGACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks