EMAIL THIS PAGE TO A FRIEND

TMEM100

transmembrane protein 100

UniProtKB ID: Q9NV29, D3DTY7, Q96FZ0
Gene ID:
Mouse(67888) transmembrane protein 100
Rat(497979) transmembrane protein 100
chicken(417398) transmembrane protein 100
dog(609661) transmembrane protein 100-like
domestic cat(101080590) transmembrane protein 100
domestic guinea pig(100724460) transmembrane protein 100
naked mole-rat(101704625) transmembrane protein 100
cow(613987) transmembrane protein 100
sheep(101118965) transmembrane protein 100
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099640 Rosetta Predictions human pricing
NM_018286 Rosetta Predictions human pricing
NM_001017479 Rosetta Predictions rat pricing
NM_026433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320833 predicted 1550
2 SASI_Hs02_00320834 predicted 1036
3 SASI_Hs02_00320835 predicted 1644
4 SASI_Hs02_00320836 predicted 1573
5 SASI_Hs02_00320837 predicted 1634
6 SASI_Hs02_00320838 predicted 1683
7 SASI_Hs02_00320839 predicted 1155
8 SASI_Hs02_00320840 predicted 1283
9 SASI_Hs02_00320841 predicted 1195
10 SASI_Hs02_00320842 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231709 predicted 1056
2 SASI_Hs01_00231710 predicted 541
3 SASI_Hs01_00231711 predicted 1151
4 SASI_Hs01_00231713 predicted 1068
5 SASI_Hs02_00351665 predicted 1138
6 SASI_Hs01_00231716 predicted 1185
7 SASI_Hs01_00231717 predicted 652
8 SASI_Hs01_00231718 predicted 782
9 SASI_Hs02_00351666 predicted 697
10 SASI_Hs02_00351667 predicted 804
11 SASI_Hs01_00231712 predicted 608
12 SASI_Hs01_00231714 predicted 234
13 SASI_Hs01_00231715 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112931 predicted 905
2 SASI_Rn01_00112932 predicted 972
3 SASI_Rn01_00112933 predicted 946
4 SASI_Rn01_00112935 predicted 811
5 SASI_Rn01_00112936 predicted 616
6 SASI_Rn01_00112937 predicted 673
7 SASI_Rn01_00112938 predicted 1027
8 SASI_Rn02_00202289 predicted 736
9 SASI_Rn01_00112939 predicted 721
10 SASI_Rn01_00112940 predicted 1088
11 SASI_Rn01_00112934 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147642 predicted 984
2 SASI_Mm01_00147643 predicted 926
3 SASI_Mm01_00147644 predicted 991
4 SASI_Mm01_00147645 predicted 1193
5 SASI_Mm01_00147646 predicted 1103
6 SASI_Mm01_00147648 predicted 857
7 SASI_Mm01_00147649 predicted 995
8 SASI_Mm01_00147650 predicted 1175
9 SASI_Mm01_00147651 predicted 999
10 SASI_Mm02_00330251 predicted 912
11 SASI_Mm01_00147647 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026433
TMEM100 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 100
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1298s1c1
Sequence:CCGGGCACAGCATTAAATAACAGTTCTCGAGAACTGTTATTTAATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-826s1c1
Sequence:CCGGCTGTGGCTTACAGCTTCAATTCTCGAGAATTGAAGCTGTAAGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1055s1c1
Sequence:CCGGGCTCTAACTCAGTGAACTCATCTCGAGATGAGTTCACTGAGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-987s1c1
Sequence:CCGGGTAAATCAGAGGTGCTTGTTTCTCGAGAAACAAGCACCTCTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026433
TMEM100 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 100
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1298s1c1
Sequence:CCGGGCACAGCATTAAATAACAGTTCTCGAGAACTGTTATTTAATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-826s1c1
Sequence:CCGGCTGTGGCTTACAGCTTCAATTCTCGAGAATTGAAGCTGTAAGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1055s1c1
Sequence:CCGGGCTCTAACTCAGTGAACTCATCTCGAGATGAGTTCACTGAGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-987s1c1
Sequence:CCGGGTAAATCAGAGGTGCTTGTTTCTCGAGAAACAAGCACCTCTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026433
TMEM100 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 100
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1298s1c1
Sequence:CCGGGCACAGCATTAAATAACAGTTCTCGAGAACTGTTATTTAATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-826s1c1
Sequence:CCGGCTGTGGCTTACAGCTTCAATTCTCGAGAATTGAAGCTGTAAGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026433.1-1055s1c1
Sequence:CCGGGCTCTAACTCAGTGAACTCATCTCGAGATGAGTTCACTGAGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026433.1-987s1c1
Sequence:CCGGGTAAATCAGAGGTGCTTGTTTCTCGAGAAACAAGCACCTCTGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018286
VALIDATED
TMEM100 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 100
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-603s1c1
Sequence:CCGGCGTGGCAAATCAGAGAAGCTTCTCGAGAAGCTTCTCTGATTTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-592s1c1
Sequence:CCGGCAAACAGCTCTCGTGGCAAATCTCGAGATTTGCCACGAGAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018286.1-1424s1c1
Sequence:CCGGGCAGTTCCAAATTGCCATCTTCTCGAGAAGATGGCAATTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-691s21c1
Sequence:CCGGCAAATCAGAGAAGCTTGTTTGCTCGAGCAAACAAGCTTCTCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018286.2-1111s21c1
Sequence:CCGGATGTTCTGCCAAGGATCTAAACTCGAGTTTAGATCCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-714s21c1
Sequence:CCGGTGAGACTGAATACGACCAAATCTCGAGATTTGGTCGTATTCAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018286.2-545s21c1
Sequence:CCGGCAATTCCCATGGGTCTATTATCTCGAGATAATAGACCCATGGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018286
VALIDATED
TMEM100 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 100
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-603s1c1
Sequence:CCGGCGTGGCAAATCAGAGAAGCTTCTCGAGAAGCTTCTCTGATTTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-592s1c1
Sequence:CCGGCAAACAGCTCTCGTGGCAAATCTCGAGATTTGCCACGAGAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018286.1-1424s1c1
Sequence:CCGGGCAGTTCCAAATTGCCATCTTCTCGAGAAGATGGCAATTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-691s21c1
Sequence:CCGGCAAATCAGAGAAGCTTGTTTGCTCGAGCAAACAAGCTTCTCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018286.2-1111s21c1
Sequence:CCGGATGTTCTGCCAAGGATCTAAACTCGAGTTTAGATCCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-714s21c1
Sequence:CCGGTGAGACTGAATACGACCAAATCTCGAGATTTGGTCGTATTCAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018286.2-545s21c1
Sequence:CCGGCAATTCCCATGGGTCTATTATCTCGAGATAATAGACCCATGGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018286
VALIDATED
TMEM100 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 100
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-603s1c1
Sequence:CCGGCGTGGCAAATCAGAGAAGCTTCTCGAGAAGCTTCTCTGATTTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018286.1-592s1c1
Sequence:CCGGCAAACAGCTCTCGTGGCAAATCTCGAGATTTGCCACGAGAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018286.1-1424s1c1
Sequence:CCGGGCAGTTCCAAATTGCCATCTTCTCGAGAAGATGGCAATTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-691s21c1
Sequence:CCGGCAAATCAGAGAAGCTTGTTTGCTCGAGCAAACAAGCTTCTCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018286.2-1111s21c1
Sequence:CCGGATGTTCTGCCAAGGATCTAAACTCGAGTTTAGATCCTTGGCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018286.2-714s21c1
Sequence:CCGGTGAGACTGAATACGACCAAATCTCGAGATTTGGTCGTATTCAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018286.2-545s21c1
Sequence:CCGGCAATTCCCATGGGTCTATTATCTCGAGATAATAGACCCATGGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks