EMAIL THIS PAGE TO A FRIEND

TMEM101

transmembrane protein 101

UniProtKB ID: Q96IK0, B2R9N6
Gene ID:
Mouse(76547) transmembrane protein 101
Rat(303564) transmembrane protein 101
cow(515507) transmembrane protein 101
sheep(101112911) transmembrane protein 101
naked mole-rat(101725602) transmembrane protein 101
domestic guinea pig(100723802) transmembrane protein 101
chicken(776864) transmembrane protein 101
dog(607173) transmembrane protein 101
domestic cat(101097284) transmembrane protein 101
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032376 Rosetta Predictions human pricing
XM_001081505 Rosetta Predictions rat pricing
XM_220940 Rosetta Predictions rat pricing
NM_029649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116150 predicted 597
2 SASI_Hs01_00116151 predicted 336
3 SASI_Hs01_00116153 predicted 1285
4 SASI_Hs02_00359763 predicted 1144
5 SASI_Hs01_00116154 predicted 1202
6 SASI_Hs02_00359764 predicted 326
7 SASI_Hs01_00116155 predicted 459
8 SASI_Hs01_00116156 predicted 362
9 SASI_Hs01_00116157 predicted 1200
10 SASI_Hs01_00116158 predicted 208
11 SASI_Hs01_00116152 predicted 1144
12 SASI_Hs01_00116159 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372203 predicted 376
2 SASI_Rn02_00372204 predicted 686
3 SASI_Rn02_00372205 predicted 716
4 SASI_Rn02_00372206 predicted 498
5 SASI_Rn02_00372207 predicted 744
6 SASI_Rn02_00372208 predicted 906
7 SASI_Rn02_00372209 predicted 747
8 SASI_Rn02_00372210 predicted 264
9 SASI_Rn02_00372211 predicted 197
10 SASI_Rn02_00372212 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379694 predicted 373
2 SASI_Rn02_00379695 predicted 693
3 SASI_Rn02_00379696 predicted 722
4 SASI_Rn02_00379697 predicted 495
5 SASI_Rn02_00379698 predicted 1120
6 SASI_Rn02_00379699 predicted 744
7 SASI_Rn02_00379700 predicted 905
8 SASI_Rn02_00379701 predicted 266
9 SASI_Rn02_00379702 predicted 197
10 SASI_Rn02_00379703 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193580 predicted 331
2 SASI_Mm01_00193582 predicted 642
3 SASI_Mm01_00193583 predicted 456
4 SASI_Mm01_00193584 predicted 622
5 SASI_Mm02_00335649 predicted 319
6 SASI_Mm02_00335650 predicted 332
7 SASI_Mm02_00335651 predicted 624
8 SASI_Mm01_00193585 predicted 226
9 SASI_Mm01_00193586 predicted 276
10 SASI_Mm01_00193588 predicted 339
11 SASI_Mm01_00193581 predicted 554
12 SASI_Mm01_00193587 predicted 221
13 SASI_Mm01_00193589 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032376
VALIDATED
TMEM101 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 101
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-684s21c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-334s21c1
Sequence:CCGGCTGGCTGAAGGTCCGTATGTACTCGAGTACATACGGACCTTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-175s21c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-277s21c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-865s21c1
Sequence:CCGGCTGGCCCAGCTGCTGTTTATTCTCGAGAATAAACAGCAGCTGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-52s1c1
Sequence:CCGGGTGGATGTTGCAGCTGATCATCTCGAGATGATCAGCTGCAACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-714s1c1
Sequence:CCGGGTGTTGAGTTCTGGAACCAGACTCGAGTCTGGTTCCAGAACTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-175s1c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-277s1c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-667s1c1
Sequence:CCGGCATGCTGCTCATTGATGGCAACTCGAGTTGCCATCAATGAGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032376.2-1131s1c1
Sequence:CCGGCAGAGGAAGGAAGATGGAGATCTCGAGATCTCCATCTTCCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-938s1c1
Sequence:CCGGGCAGTTAAGAGGCAGCTCATTCTCGAGAATGAGCTGCCTCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-684s1c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032376
VALIDATED
TMEM101 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 101
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-684s21c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-334s21c1
Sequence:CCGGCTGGCTGAAGGTCCGTATGTACTCGAGTACATACGGACCTTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-175s21c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-277s21c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-865s21c1
Sequence:CCGGCTGGCCCAGCTGCTGTTTATTCTCGAGAATAAACAGCAGCTGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-52s1c1
Sequence:CCGGGTGGATGTTGCAGCTGATCATCTCGAGATGATCAGCTGCAACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-714s1c1
Sequence:CCGGGTGTTGAGTTCTGGAACCAGACTCGAGTCTGGTTCCAGAACTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-175s1c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-277s1c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-667s1c1
Sequence:CCGGCATGCTGCTCATTGATGGCAACTCGAGTTGCCATCAATGAGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032376.2-1131s1c1
Sequence:CCGGCAGAGGAAGGAAGATGGAGATCTCGAGATCTCCATCTTCCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-938s1c1
Sequence:CCGGGCAGTTAAGAGGCAGCTCATTCTCGAGAATGAGCTGCCTCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-684s1c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032376
VALIDATED
TMEM101 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 101
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-684s21c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-334s21c1
Sequence:CCGGCTGGCTGAAGGTCCGTATGTACTCGAGTACATACGGACCTTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-175s21c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-277s21c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032376.2-865s21c1
Sequence:CCGGCTGGCCCAGCTGCTGTTTATTCTCGAGAATAAACAGCAGCTGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-52s1c1
Sequence:CCGGGTGGATGTTGCAGCTGATCATCTCGAGATGATCAGCTGCAACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032376.2-714s1c1
Sequence:CCGGGTGTTGAGTTCTGGAACCAGACTCGAGTCTGGTTCCAGAACTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-175s1c1
Sequence:CCGGCCCAGTGCCTTACCTGTATTTCTCGAGAAATACAGGTAAGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032376.2-277s1c1
Sequence:CCGGCCAATTGGCCATTAGCACCTACTCGAGTAGGTGCTAATGGCCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-667s1c1
Sequence:CCGGCATGCTGCTCATTGATGGCAACTCGAGTTGCCATCAATGAGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032376.2-1131s1c1
Sequence:CCGGCAGAGGAAGGAAGATGGAGATCTCGAGATCTCCATCTTCCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-938s1c1
Sequence:CCGGGCAGTTAAGAGGCAGCTCATTCTCGAGAATGAGCTGCCTCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032376.2-684s1c1
Sequence:CCGGGCAATGTTGCTTACTGGCACACTCGAGTGTGCCAGTAAGCAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029649
TMEM101 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 101
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029649.1-960s21c1
Sequence:CCGGCCTTGCGCTAAAGCTTCATAGCTCGAGCTATGAAGCTTTAGCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-595s21c1
Sequence:CCGGCCTTCTTGTCGGGTTACTATGCTCGAGCATAGTAACCCGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-328s21c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-558s1c1
Sequence:CCGGCAGCTGTTCTTCGTGCTTTATCTCGAGATAAAGCACGAAGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-328s1c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-164s21c1
Sequence:CCGGCATCCCAGTGCCTTATCTATACTCGAGTATAGATAAGGCACTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-119s21c1
Sequence:CCGGACTTATGTTGTACGCTGAAAGCTCGAGCTTTCAGCGTACAACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029649.1-859s1c1
Sequence:CCGGGCTGGCCCAGTTGTTGTTTATCTCGAGATAAACAACAACTGGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-218s1c1
Sequence:CCGGCTTCATGTCCTTCGGAGTGAACTCGAGTTCACTCCGAAGGACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029649
TMEM101 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 101
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029649.1-960s21c1
Sequence:CCGGCCTTGCGCTAAAGCTTCATAGCTCGAGCTATGAAGCTTTAGCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-595s21c1
Sequence:CCGGCCTTCTTGTCGGGTTACTATGCTCGAGCATAGTAACCCGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-328s21c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-558s1c1
Sequence:CCGGCAGCTGTTCTTCGTGCTTTATCTCGAGATAAAGCACGAAGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-328s1c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-164s21c1
Sequence:CCGGCATCCCAGTGCCTTATCTATACTCGAGTATAGATAAGGCACTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-119s21c1
Sequence:CCGGACTTATGTTGTACGCTGAAAGCTCGAGCTTTCAGCGTACAACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029649.1-859s1c1
Sequence:CCGGGCTGGCCCAGTTGTTGTTTATCTCGAGATAAACAACAACTGGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-218s1c1
Sequence:CCGGCTTCATGTCCTTCGGAGTGAACTCGAGTTCACTCCGAAGGACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029649
TMEM101 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 101
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029649.1-960s21c1
Sequence:CCGGCCTTGCGCTAAAGCTTCATAGCTCGAGCTATGAAGCTTTAGCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-595s21c1
Sequence:CCGGCCTTCTTGTCGGGTTACTATGCTCGAGCATAGTAACCCGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-328s21c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-558s1c1
Sequence:CCGGCAGCTGTTCTTCGTGCTTTATCTCGAGATAAAGCACGAAGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-328s1c1
Sequence:CCGGGGCTAAAGGTCCGTATGTATTCTCGAGAATACATACGGACCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-164s21c1
Sequence:CCGGCATCCCAGTGCCTTATCTATACTCGAGTATAGATAAGGCACTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029649.1-119s21c1
Sequence:CCGGACTTATGTTGTACGCTGAAAGCTCGAGCTTTCAGCGTACAACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029649.1-859s1c1
Sequence:CCGGGCTGGCCCAGTTGTTGTTTATCTCGAGATAAACAACAACTGGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029649.1-218s1c1
Sequence:CCGGCTTCATGTCCTTCGGAGTGAACTCGAGTTCACTCCGAAGGACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks