EMAIL THIS PAGE TO A FRIEND

TMEM102

transmembrane protein 102

Synonyms: CBAP
UniProtKB ID: Q8N9M5, D3DTP8
Gene ID:
Mouse(380705) transmembrane protein 102
Rat(497937) transmembrane protein 102
Horse(100061842) transmembrane protein 102
dog(489472) transmembrane protein 102
domestic cat(101096929) transmembrane protein 102
domestic guinea pig(100714654) transmembrane protein 102
naked mole-rat(101722937) transmembrane protein 102
Domestic Rabbit(100357675) transmembrane protein 102
cow(508014) transmembrane protein 102
sheep(101121359) transmembrane protein 102
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178518 Rosetta Predictions human pricing
XM_001079550 Rosetta Predictions rat pricing
XM_573124 Rosetta Predictions rat pricing
NM_001033433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094570 predicted 676
2 SASI_Hs01_00094571 predicted 653
3 SASI_Hs01_00094572 predicted 948
4 SASI_Hs01_00094573 predicted 994
5 SASI_Hs01_00094574 predicted 624
6 SASI_Hs01_00094575 predicted 812
7 SASI_Hs01_00094576 predicted 1032
8 SASI_Hs02_00369759 predicted 944
9 SASI_Hs01_00094577 predicted 533
10 SASI_Hs01_00094578 predicted 807
11 SASI_Hs01_00094579 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364657 predicted 2203
2 SASI_Rn02_00364658 predicted 1912
3 SASI_Rn02_00364659 predicted 2214
4 SASI_Rn02_00364660 predicted 1026
5 SASI_Rn02_00364661 predicted 1182
6 SASI_Rn02_00364662 predicted 1075
7 SASI_Rn02_00364663 predicted 1916
8 SASI_Rn02_00364664 predicted 920
9 SASI_Rn02_00364665 predicted 1165
10 SASI_Rn02_00364666 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399874 predicted 1324
2 SASI_Rn02_00399875 predicted 3894
3 SASI_Rn02_00399876 predicted 1488
4 SASI_Rn02_00399877 predicted 1745
5 SASI_Rn02_00399878 predicted 3906
6 SASI_Rn02_00399879 predicted 1668
7 SASI_Rn02_00399880 predicted 1555
8 SASI_Rn02_00399881 predicted 1592
9 SASI_Rn02_00399882 predicted 1879
10 SASI_Rn02_00399883 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060129 predicted 1004
2 SASI_Mm01_00060130 predicted 1190
3 SASI_Mm01_00060131 predicted 1064
4 SASI_Mm01_00060132 predicted 1224
5 SASI_Mm01_00060133 predicted 1086
6 SASI_Mm01_00060134 predicted 766
7 SASI_Mm01_00060136 predicted 959
8 SASI_Mm01_00060137 predicted 1077
9 SASI_Mm01_00060138 predicted 1420
10 SASI_Mm02_00288745 predicted 712
11 SASI_Mm01_00060135 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178518
TMEM102 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 102
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-814s1c1
Sequence:CCGGGAAAGTTCCAAGGACTGGCAACTCGAGTTGCCAGTCCTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-466s1c1
Sequence:CCGGGACTTTGTCTTCTCTTTGCTTCTCGAGAAGCAAAGAGAAGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178518.2-1805s21c1
Sequence:CCGGGCTGTTCCTACCAGTGGAAAGCTCGAGCTTTCCACTGGTAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-797s21c1
Sequence:CCGGACCGAACGGAGAGCGAAGAAACTCGAGTTTCTTCGCTCTCCGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-676s21c1
Sequence:CCGGCTGGACCTGGAATCCTGTTACCTCGAGGTAACAGGATTCCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-630s21c1
Sequence:CCGGCACACTCCTAGTGCCCATGTTCTCGAGAACATGGGCACTAGGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-1614s21c1
Sequence:CCGGCGGGACGTTGCCTCACTATTTCTCGAGAAATAGTGAGGCAACGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178518
TMEM102 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 102
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-814s1c1
Sequence:CCGGGAAAGTTCCAAGGACTGGCAACTCGAGTTGCCAGTCCTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-466s1c1
Sequence:CCGGGACTTTGTCTTCTCTTTGCTTCTCGAGAAGCAAAGAGAAGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178518.2-1805s21c1
Sequence:CCGGGCTGTTCCTACCAGTGGAAAGCTCGAGCTTTCCACTGGTAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-797s21c1
Sequence:CCGGACCGAACGGAGAGCGAAGAAACTCGAGTTTCTTCGCTCTCCGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-676s21c1
Sequence:CCGGCTGGACCTGGAATCCTGTTACCTCGAGGTAACAGGATTCCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-630s21c1
Sequence:CCGGCACACTCCTAGTGCCCATGTTCTCGAGAACATGGGCACTAGGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-1614s21c1
Sequence:CCGGCGGGACGTTGCCTCACTATTTCTCGAGAAATAGTGAGGCAACGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178518
TMEM102 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 102
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-814s1c1
Sequence:CCGGGAAAGTTCCAAGGACTGGCAACTCGAGTTGCCAGTCCTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178518.2-466s1c1
Sequence:CCGGGACTTTGTCTTCTCTTTGCTTCTCGAGAAGCAAAGAGAAGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178518.2-1805s21c1
Sequence:CCGGGCTGTTCCTACCAGTGGAAAGCTCGAGCTTTCCACTGGTAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-797s21c1
Sequence:CCGGACCGAACGGAGAGCGAAGAAACTCGAGTTTCTTCGCTCTCCGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-676s21c1
Sequence:CCGGCTGGACCTGGAATCCTGTTACCTCGAGGTAACAGGATTCCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-630s21c1
Sequence:CCGGCACACTCCTAGTGCCCATGTTCTCGAGAACATGGGCACTAGGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178518.2-1614s21c1
Sequence:CCGGCGGGACGTTGCCTCACTATTTCTCGAGAAATAGTGAGGCAACGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033433
TMEM102 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 102
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-883s21c1
Sequence:CCGGCAGAACTGATGCGTGGAATTTCTCGAGAAATTCCACGCATCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1083s21c1
Sequence:CCGGTCAGAGTCCCAATCGTCTTATCTCGAGATAAGACGATTGGGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-775s21c1
Sequence:CCGGCTCATTATGATGCCGGCTTTACTCGAGTAAAGCCGGCATCATAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-720s21c1
Sequence:CCGGCGCGAAGGTTCCCTAGATTTACTCGAGTAAATCTAGGGAACCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1011s21c1
Sequence:CCGGGTAGATCCGTCACATGATTATCTCGAGATAATCATGTGACGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033433
TMEM102 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 102
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-883s21c1
Sequence:CCGGCAGAACTGATGCGTGGAATTTCTCGAGAAATTCCACGCATCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1083s21c1
Sequence:CCGGTCAGAGTCCCAATCGTCTTATCTCGAGATAAGACGATTGGGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-775s21c1
Sequence:CCGGCTCATTATGATGCCGGCTTTACTCGAGTAAAGCCGGCATCATAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-720s21c1
Sequence:CCGGCGCGAAGGTTCCCTAGATTTACTCGAGTAAATCTAGGGAACCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1011s21c1
Sequence:CCGGGTAGATCCGTCACATGATTATCTCGAGATAATCATGTGACGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033433
TMEM102 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 102
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-883s21c1
Sequence:CCGGCAGAACTGATGCGTGGAATTTCTCGAGAAATTCCACGCATCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1083s21c1
Sequence:CCGGTCAGAGTCCCAATCGTCTTATCTCGAGATAAGACGATTGGGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-775s21c1
Sequence:CCGGCTCATTATGATGCCGGCTTTACTCGAGTAAAGCCGGCATCATAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-720s21c1
Sequence:CCGGCGCGAAGGTTCCCTAGATTTACTCGAGTAAATCTAGGGAACCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033433.3-1011s21c1
Sequence:CCGGGTAGATCCGTCACATGATTATCTCGAGATAATCATGTGACGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks