EMAIL THIS PAGE TO A FRIEND

TMEM104

transmembrane protein 104

UniProtKB ID: Q8NE00, Q8TEU1, Q9NT56, Q9NXH1
Gene ID:
Mouse(320534) transmembrane protein 104
Rat(303670) transmembrane protein 104
cow(516807) transmembrane protein 104
sheep(101112074) transmembrane protein 104
Domestic Rabbit(100356600) transmembrane protein 104
naked mole-rat(101698050) transmembrane protein 104
domestic guinea pig(100720593) transmembrane protein 104
Zebrafish(565387) transmembrane protein 104
Horse(100052466) transmembrane protein 104
domestic cat(101095781) transmembrane protein 104
dog(483301) transmembrane protein 104
chicken(422110) transmembrane protein 104
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017728 Rosetta Predictions human pricing
XM_001081674 Rosetta Predictions rat pricing
XM_221104 Rosetta Predictions rat pricing
NM_001033393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218661 predicted 780
2 SASI_Hs01_00218662 predicted 1291
3 SASI_Hs01_00218663 predicted 589
4 SASI_Hs01_00218664 predicted 1892
5 SASI_Hs01_00218665 predicted 1620
6 SASI_Hs01_00218666 predicted 842
7 SASI_Hs01_00218667 predicted 1927
8 SASI_Hs02_00350504 predicted 727
9 SASI_Hs01_00218669 predicted 867
10 SASI_Hs01_00218668 predicted 598
11 SASI_Hs01_00218670 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372942 predicted 216
2 SASI_Rn02_00372943 predicted 528
3 SASI_Rn02_00372944 predicted 226
4 SASI_Rn02_00372945 predicted 863
5 SASI_Rn02_00372946 predicted 1106
6 SASI_Rn02_00372947 predicted 623
7 SASI_Rn02_00372948 predicted 803
8 SASI_Rn02_00372949 predicted 1632
9 SASI_Rn02_00372950 predicted 1595
10 SASI_Rn02_00372951 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379854 predicted 790
2 SASI_Rn02_00379855 predicted 308
3 SASI_Rn02_00379856 predicted 603
4 SASI_Rn02_00379857 predicted 213
5 SASI_Rn02_00379858 predicted 524
6 SASI_Rn02_00379859 predicted 791
7 SASI_Rn02_00379860 predicted 229
8 SASI_Rn02_00379861 predicted 863
9 SASI_Rn02_00379862 predicted 840
10 SASI_Rn02_00379863 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063166 predicted 839
2 SASI_Mm01_00063167 predicted 764
3 SASI_Mm01_00063168 predicted 1485
4 SASI_Mm02_00288694 predicted 705
5 SASI_Mm01_00063169 predicted 1069
6 SASI_Mm01_00063170 predicted 1599
7 SASI_Mm01_00063171 predicted 1268
8 SASI_Mm01_00063172 predicted 705
9 SASI_Mm01_00063173 predicted 848
10 SASI_Mm01_00063174 predicted 676
11 SASI_Mm01_00063165 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033393
TMEM104 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 104
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-698s21c1
Sequence:CCGGGTGGATACAGACGCCAGATACCTCGAGGTATCTGGCGTCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-798s21c1
Sequence:CCGGTTGGCCCGTTCACCTTCTTTGCTCGAGCAAAGAAGGTGAACGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033393.1-3666s21c1
Sequence:CCGGTAGCATTTGTGGGTATCATTTCTCGAGAAATGATACCCACAAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-756s21c1
Sequence:CCGGTGGATGTCTACCGAATCTATCCTCGAGGATAGATTCGGTAGACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-189s21c1
Sequence:CCGGTCGGGCTGGTGTACATGTTTACTCGAGTAAACATGTACACCAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033393
TMEM104 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 104
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-698s21c1
Sequence:CCGGGTGGATACAGACGCCAGATACCTCGAGGTATCTGGCGTCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-798s21c1
Sequence:CCGGTTGGCCCGTTCACCTTCTTTGCTCGAGCAAAGAAGGTGAACGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033393.1-3666s21c1
Sequence:CCGGTAGCATTTGTGGGTATCATTTCTCGAGAAATGATACCCACAAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-756s21c1
Sequence:CCGGTGGATGTCTACCGAATCTATCCTCGAGGATAGATTCGGTAGACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-189s21c1
Sequence:CCGGTCGGGCTGGTGTACATGTTTACTCGAGTAAACATGTACACCAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033393
TMEM104 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 104
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-698s21c1
Sequence:CCGGGTGGATACAGACGCCAGATACCTCGAGGTATCTGGCGTCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-798s21c1
Sequence:CCGGTTGGCCCGTTCACCTTCTTTGCTCGAGCAAAGAAGGTGAACGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033393.1-3666s21c1
Sequence:CCGGTAGCATTTGTGGGTATCATTTCTCGAGAAATGATACCCACAAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-756s21c1
Sequence:CCGGTGGATGTCTACCGAATCTATCCTCGAGGATAGATTCGGTAGACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033393.1-189s21c1
Sequence:CCGGTCGGGCTGGTGTACATGTTTACTCGAGTAAACATGTACACCAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017728
VALIDATED
TMEM104 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 104
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-3122s1c1
Sequence:CCGGCCTCAGTGTTTCTCATAGCTTCTCGAGAAGCTATGAGAAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-1574s1c1
Sequence:CCGGCCAATATCATCCTCAGCGAGACTCGAGTCTCGCTGAGGATGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2017s1c1
Sequence:CCGGCCTGCGTCCTTGTCTAAGAAACTCGAGTTTCTTAGACAAGGACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-827s1c1
Sequence:CCGGCTCTGATGAGATGGATCGCTTCTCGAGAAGCGATCCATCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-822s1c1
Sequence:CCGGGACCTCTCTGATGAGATGGATCTCGAGATCCATCTCATCAGAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-498s1c1
Sequence:CCGGCCGGGTGGAAATGGGACAAATCTCGAGATTTGTCCCATTTCCACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-552s1c1
Sequence:CCGGCTTGTTCTATTTCTGCATCATCTCGAGATGATGCAGAAATAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2184s1c1
Sequence:CCGGGACAAGAACAAGAAGTGCTAACTCGAGTTAGCACTTCTTGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017728
VALIDATED
TMEM104 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 104
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-3122s1c1
Sequence:CCGGCCTCAGTGTTTCTCATAGCTTCTCGAGAAGCTATGAGAAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-1574s1c1
Sequence:CCGGCCAATATCATCCTCAGCGAGACTCGAGTCTCGCTGAGGATGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2017s1c1
Sequence:CCGGCCTGCGTCCTTGTCTAAGAAACTCGAGTTTCTTAGACAAGGACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-827s1c1
Sequence:CCGGCTCTGATGAGATGGATCGCTTCTCGAGAAGCGATCCATCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-822s1c1
Sequence:CCGGGACCTCTCTGATGAGATGGATCTCGAGATCCATCTCATCAGAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-498s1c1
Sequence:CCGGCCGGGTGGAAATGGGACAAATCTCGAGATTTGTCCCATTTCCACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-552s1c1
Sequence:CCGGCTTGTTCTATTTCTGCATCATCTCGAGATGATGCAGAAATAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2184s1c1
Sequence:CCGGGACAAGAACAAGAAGTGCTAACTCGAGTTAGCACTTCTTGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017728
VALIDATED
TMEM104 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 104
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-3122s1c1
Sequence:CCGGCCTCAGTGTTTCTCATAGCTTCTCGAGAAGCTATGAGAAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-1574s1c1
Sequence:CCGGCCAATATCATCCTCAGCGAGACTCGAGTCTCGCTGAGGATGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2017s1c1
Sequence:CCGGCCTGCGTCCTTGTCTAAGAAACTCGAGTTTCTTAGACAAGGACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-827s1c1
Sequence:CCGGCTCTGATGAGATGGATCGCTTCTCGAGAAGCGATCCATCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-822s1c1
Sequence:CCGGGACCTCTCTGATGAGATGGATCTCGAGATCCATCTCATCAGAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017728.2-498s1c1
Sequence:CCGGCCGGGTGGAAATGGGACAAATCTCGAGATTTGTCCCATTTCCACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017728.2-552s1c1
Sequence:CCGGCTTGTTCTATTTCTGCATCATCTCGAGATGATGCAGAAATAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017728.2-2184s1c1
Sequence:CCGGGACAAGAACAAGAAGTGCTAACTCGAGTTAGCACTTCTTGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks