EMAIL THIS PAGE TO A FRIEND

TMEM105

transmembrane protein 105

Species: Human TMEM105(284186)
UniProtKB ID: Q8N8V8
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026011 MISSION® esiRNA esiRNA human TMEM105 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369764 predicted 768
2 SASI_Hs01_00112274 predicted 602
3 SASI_Hs01_00112275 predicted 1188
4 SASI_Hs01_00112276 predicted 973
5 SASI_Hs01_00112277 predicted 596
6 SASI_Hs02_00369765 predicted 939
7 SASI_Hs01_00112278 predicted 638
8 SASI_Hs01_00112280 predicted 1186
9 SASI_Hs01_00112282 predicted 782
10 SASI_Hs01_00112283 predicted 792
11 SASI_Hs01_00112279 predicted 853
12 SASI_Hs01_00112281 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178520
TMEM105 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 105
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-784s1c1
Sequence:CCGGGATAAGAAGGCGAAGACATGACTCGAGTCATGTCTTCGCCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-776s1c1
Sequence:CCGGGAGATGAAGATAAGAAGGCGACTCGAGTCGCCTTCTTATCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-772s1c1
Sequence:CCGGCTGTGAGATGAAGATAAGAAGCTCGAGCTTCTTATCTTCATCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2286s1c1
Sequence:CCGGCCTCTCAAAGCACTGGGATTACTCGAGTAATCCCAGTGCTTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-778s1c1
Sequence:CCGGGATGAAGATAAGAAGGCGAAGCTCGAGCTTCGCCTTCTTATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2253s1c1
Sequence:CCGGGCTGATCTCAAACTCCTGATACTCGAGTATCAGGAGTTTGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-766s1c1
Sequence:CCGGCTGCCTCTGTGAGATGAAGATCTCGAGATCTTCATCTCACAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-604s21c1
Sequence:CCGGAGGAGCTTTCAGGGCAGGAAACTCGAGTTTCCTGCCCTGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-626s21c1
Sequence:CCGGGTGATCGGGCAGCTGATTTATCTCGAGATAAATCAGCTGCCCGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178520.2-1182s21c1
Sequence:CCGGCTGATCTTACAACGAGGTATGCTCGAGCATACCTCGTTGTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178520
TMEM105 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 105
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-784s1c1
Sequence:CCGGGATAAGAAGGCGAAGACATGACTCGAGTCATGTCTTCGCCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-776s1c1
Sequence:CCGGGAGATGAAGATAAGAAGGCGACTCGAGTCGCCTTCTTATCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-772s1c1
Sequence:CCGGCTGTGAGATGAAGATAAGAAGCTCGAGCTTCTTATCTTCATCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2286s1c1
Sequence:CCGGCCTCTCAAAGCACTGGGATTACTCGAGTAATCCCAGTGCTTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-778s1c1
Sequence:CCGGGATGAAGATAAGAAGGCGAAGCTCGAGCTTCGCCTTCTTATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2253s1c1
Sequence:CCGGGCTGATCTCAAACTCCTGATACTCGAGTATCAGGAGTTTGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-766s1c1
Sequence:CCGGCTGCCTCTGTGAGATGAAGATCTCGAGATCTTCATCTCACAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-604s21c1
Sequence:CCGGAGGAGCTTTCAGGGCAGGAAACTCGAGTTTCCTGCCCTGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-626s21c1
Sequence:CCGGGTGATCGGGCAGCTGATTTATCTCGAGATAAATCAGCTGCCCGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178520.2-1182s21c1
Sequence:CCGGCTGATCTTACAACGAGGTATGCTCGAGCATACCTCGTTGTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178520
TMEM105 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 105
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-784s1c1
Sequence:CCGGGATAAGAAGGCGAAGACATGACTCGAGTCATGTCTTCGCCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-776s1c1
Sequence:CCGGGAGATGAAGATAAGAAGGCGACTCGAGTCGCCTTCTTATCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-772s1c1
Sequence:CCGGCTGTGAGATGAAGATAAGAAGCTCGAGCTTCTTATCTTCATCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2286s1c1
Sequence:CCGGCCTCTCAAAGCACTGGGATTACTCGAGTAATCCCAGTGCTTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-778s1c1
Sequence:CCGGGATGAAGATAAGAAGGCGAAGCTCGAGCTTCGCCTTCTTATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178520.2-2253s1c1
Sequence:CCGGGCTGATCTCAAACTCCTGATACTCGAGTATCAGGAGTTTGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178520.2-766s1c1
Sequence:CCGGCTGCCTCTGTGAGATGAAGATCTCGAGATCTTCATCTCACAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-604s21c1
Sequence:CCGGAGGAGCTTTCAGGGCAGGAAACTCGAGTTTCCTGCCCTGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178520.2-626s21c1
Sequence:CCGGGTGATCGGGCAGCTGATTTATCTCGAGATAAATCAGCTGCCCGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178520.2-1182s21c1
Sequence:CCGGCTGATCTTACAACGAGGTATGCTCGAGCATACCTCGTTGTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks