EMAIL THIS PAGE TO A FRIEND

TMEM106A

transmembrane protein 106A

UniProtKB ID: Q96A25, A8K2X2
Gene ID:
Mouse(217203) transmembrane protein 106A
Rat(287722) transmembrane protein 106A
Zebrafish(407612) transmembrane protein 106A
dog(490951) transmembrane protein 106A
domestic cat(101094147) transmembrane protein 106A
domestic guinea pig(100722887) transmembrane protein 106A
naked mole-rat(101720233) transmembrane protein 106A
cow(508269) transmembrane protein 106A
sheep(101109284) transmembrane protein 106A
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500658 Anti-TMEM106A antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145041 Rosetta Predictions human pricing
NM_001024967 Rosetta Predictions rat pricing
NM_144830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194543 predicted 759
2 SASI_Hs01_00194545 predicted 858
3 SASI_Hs01_00194547 predicted 499
4 SASI_Hs02_00364918 predicted 942
5 SASI_Hs01_00194548 predicted 527
6 SASI_Hs01_00194549 predicted 545
7 SASI_Hs01_00194550 predicted 620
8 SASI_Hs02_00364919 predicted 655
9 SASI_Hs02_00364920 predicted 652
10 SASI_Hs01_00194551 predicted 777
11 SASI_Hs01_00194544 predicted 917
12 SASI_Hs01_00194546 predicted 793
13 SASI_Hs01_00194552 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034482 predicted 846
2 SASI_Rn01_00034484 predicted 755
3 SASI_Rn01_00034486 predicted 1310
4 SASI_Rn01_00034488 predicted 692
5 SASI_Rn01_00034489 predicted 640
6 SASI_Rn01_00034490 predicted 1352
7 SASI_Rn01_00034491 predicted 1272
8 SASI_Rn02_00202818 predicted 704
9 SASI_Rn02_00202819 predicted 333
10 SASI_Rn02_00202820 predicted 1020
11 SASI_Rn01_00034483 predicted 845
12 SASI_Rn01_00034485 predicted 859
13 SASI_Rn01_00034487 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057297 predicted 301
2 SASI_Mm01_00057299 predicted 328
3 SASI_Mm01_00057300 predicted 442
4 SASI_Mm01_00057301 predicted 736
5 SASI_Mm01_00057302 predicted 631
6 SASI_Mm01_00057303 predicted 1032
7 SASI_Mm01_00057304 predicted 890
8 SASI_Mm01_00057305 predicted 1127
9 SASI_Mm01_00057306 predicted 584
10 SASI_Mm02_00340212 predicted 1449
11 SASI_Mm01_00057298 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144830
VALIDATED
TMEM106A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-228s21c1
Sequence:CCGGCAAGCCTATCCTACCTGATAACTCGAGTTATCAGGTAGGATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-406s21c1
Sequence:CCGGCTGGTTGCTCTCATCCCTTATCTCGAGATAAGGGATGAGAGCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-1171s21c1
Sequence:CCGGGTCGCTTCTGATGGATCTTACCTCGAGGTAAGATCCATCAGAAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-304s21c1
Sequence:CCGGGCACACTCCTGTATGCCTTATCTCGAGATAAGGCATACAGGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-555s21c1
Sequence:CCGGCCTCAACTCTTCCACAGTAACCTCGAGGTTACTGTGGAAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-648s1c1
Sequence:CCGGCAACACGACGAATGTCCTGAACTCGAGTTCAGGACATTCGTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-640s1c1
Sequence:CCGGGTACAGCTCAACACGACGAATCTCGAGATTCGTCGTGTTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-274s1c1
Sequence:CCGGGACAAGCCTATCCTACCTGATCTCGAGATCAGGTAGGATAGGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144830
VALIDATED
TMEM106A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-228s21c1
Sequence:CCGGCAAGCCTATCCTACCTGATAACTCGAGTTATCAGGTAGGATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-406s21c1
Sequence:CCGGCTGGTTGCTCTCATCCCTTATCTCGAGATAAGGGATGAGAGCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-1171s21c1
Sequence:CCGGGTCGCTTCTGATGGATCTTACCTCGAGGTAAGATCCATCAGAAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-304s21c1
Sequence:CCGGGCACACTCCTGTATGCCTTATCTCGAGATAAGGCATACAGGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-555s21c1
Sequence:CCGGCCTCAACTCTTCCACAGTAACCTCGAGGTTACTGTGGAAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-648s1c1
Sequence:CCGGCAACACGACGAATGTCCTGAACTCGAGTTCAGGACATTCGTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-640s1c1
Sequence:CCGGGTACAGCTCAACACGACGAATCTCGAGATTCGTCGTGTTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-274s1c1
Sequence:CCGGGACAAGCCTATCCTACCTGATCTCGAGATCAGGTAGGATAGGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144830
VALIDATED
TMEM106A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-228s21c1
Sequence:CCGGCAAGCCTATCCTACCTGATAACTCGAGTTATCAGGTAGGATAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144830.3-406s21c1
Sequence:CCGGCTGGTTGCTCTCATCCCTTATCTCGAGATAAGGGATGAGAGCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-1171s21c1
Sequence:CCGGGTCGCTTCTGATGGATCTTACCTCGAGGTAAGATCCATCAGAAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-304s21c1
Sequence:CCGGGCACACTCCTGTATGCCTTATCTCGAGATAAGGCATACAGGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144830.3-555s21c1
Sequence:CCGGCCTCAACTCTTCCACAGTAACCTCGAGGTTACTGTGGAAGAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-648s1c1
Sequence:CCGGCAACACGACGAATGTCCTGAACTCGAGTTCAGGACATTCGTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-640s1c1
Sequence:CCGGGTACAGCTCAACACGACGAATCTCGAGATTCGTCGTGTTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144830.1-274s1c1
Sequence:CCGGGACAAGCCTATCCTACCTGATCTCGAGATCAGGTAGGATAGGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145041
TMEM106A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-948s21c1
Sequence:CCGGGGTCTTTCAGAGCTATGAATACTCGAGTATTCATAGCTCTGAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-651s21c1
Sequence:CCGGCTACCTCAACATAACGAATATCTCGAGATATTCGTTATGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145041.1-1055s21c1
Sequence:CCGGCCTGCAACCCTGGTCTATATCCTCGAGGATATAGACCAGGGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-815s21c1
Sequence:CCGGACGCAGTAGCTACCAAGATACCTCGAGGTATCTTGGTAGCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-767s21c1
Sequence:CCGGACAACCTTCTCCTACACATTGCTCGAGCAATGTGTAGGAGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-507s1c1
Sequence:CCGGGCACACGAAGCTCTTTGTGTTCTCGAGAACACAAAGAGCTTCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-945s1c1
Sequence:CCGGGCTGGTCTTTCAGAGCTATGACTCGAGTCATAGCTCTGAAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-946s1c1
Sequence:CCGGCTGGTCTTTCAGAGCTATGAACTCGAGTTCATAGCTCTGAAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145041
TMEM106A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-948s21c1
Sequence:CCGGGGTCTTTCAGAGCTATGAATACTCGAGTATTCATAGCTCTGAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-651s21c1
Sequence:CCGGCTACCTCAACATAACGAATATCTCGAGATATTCGTTATGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145041.1-1055s21c1
Sequence:CCGGCCTGCAACCCTGGTCTATATCCTCGAGGATATAGACCAGGGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-815s21c1
Sequence:CCGGACGCAGTAGCTACCAAGATACCTCGAGGTATCTTGGTAGCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-767s21c1
Sequence:CCGGACAACCTTCTCCTACACATTGCTCGAGCAATGTGTAGGAGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-507s1c1
Sequence:CCGGGCACACGAAGCTCTTTGTGTTCTCGAGAACACAAAGAGCTTCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-945s1c1
Sequence:CCGGGCTGGTCTTTCAGAGCTATGACTCGAGTCATAGCTCTGAAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-946s1c1
Sequence:CCGGCTGGTCTTTCAGAGCTATGAACTCGAGTTCATAGCTCTGAAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145041
TMEM106A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-948s21c1
Sequence:CCGGGGTCTTTCAGAGCTATGAATACTCGAGTATTCATAGCTCTGAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-651s21c1
Sequence:CCGGCTACCTCAACATAACGAATATCTCGAGATATTCGTTATGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145041.1-1055s21c1
Sequence:CCGGCCTGCAACCCTGGTCTATATCCTCGAGGATATAGACCAGGGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-815s21c1
Sequence:CCGGACGCAGTAGCTACCAAGATACCTCGAGGTATCTTGGTAGCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145041.1-767s21c1
Sequence:CCGGACAACCTTCTCCTACACATTGCTCGAGCAATGTGTAGGAGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-507s1c1
Sequence:CCGGGCACACGAAGCTCTTTGTGTTCTCGAGAACACAAAGAGCTTCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-945s1c1
Sequence:CCGGGCTGGTCTTTCAGAGCTATGACTCGAGTCATAGCTCTGAAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145041.1-946s1c1
Sequence:CCGGCTGGTCTTTCAGAGCTATGAACTCGAGTTCATAGCTCTGAAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks