EMAIL THIS PAGE TO A FRIEND

TMEM106B

transmembrane protein 106B

UniProtKB ID: Q9NUM4, A4D108, Q53FL9, Q8N4L0
Gene ID:
Mouse(71900) transmembrane protein 106B
Rat(312132) transmembrane protein 106B
cow(508903) transmembrane protein 106B
sheep(101122854) transmembrane protein 106B
naked mole-rat(101703812) transmembrane protein 106B
domestic guinea pig(100715910) transmembrane protein 106B
chicken(420586) transmembrane protein 106B
domestic cat(101100710) transmembrane protein 106B
dog(482322) transmembrane protein 106B-like
211 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018374 Rosetta Predictions human pricing
NM_001004267 Rosetta Predictions rat pricing
NM_027992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351852 predicted 1208
2 SASI_Hs01_00114786 predicted 989
3 SASI_Hs01_00114787 predicted 854
4 SASI_Hs01_00114788 predicted 868
5 SASI_Hs01_00114789 predicted 1185
6 SASI_Hs01_00114792 predicted 1024
7 SASI_Hs01_00114795 predicted 1043
8 SASI_Hs02_00351853 predicted 1000
9 SASI_Hs02_00351854 predicted 1214
10 SASI_Hs02_00351855 predicted 965
11 SASI_Hs01_00114790 predicted 639
12 SASI_Hs01_00114791 predicted 575
13 SASI_Hs01_00114793 predicted 975
14 SASI_Hs01_00114794 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048089 predicted 655
2 SASI_Rn01_00048090 predicted 287
3 SASI_Rn01_00048091 predicted 237
4 SASI_Rn01_00048092 predicted 890
5 SASI_Rn01_00048093 predicted 199
6 SASI_Rn01_00048094 predicted 391
7 SASI_Rn01_00048095 predicted 800
8 SASI_Rn01_00048096 predicted 673
9 SASI_Rn01_00048097 predicted 796
10 SASI_Rn01_00048098 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333058 predicted 958
2 SASI_Mm02_00333059 predicted 1173
3 SASI_Mm02_00333060 predicted 846
4 SASI_Mm02_00333061 predicted 1147
5 SASI_Mm01_00185512 predicted 927
6 SASI_Mm01_00185514 predicted 481
7 SASI_Mm01_00185515 predicted 1081
8 SASI_Mm01_00185517 predicted 986
9 SASI_Mm01_00185518 predicted 866
10 SASI_Mm01_00185519 predicted 1014
11 SASI_Mm01_00185513 predicted 493
12 SASI_Mm01_00185516 predicted 822
13 SASI_Mm01_00185520 predicted 868
14 SASI_Mm01_00185521 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027992
VALIDATED
TMEM106B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-1001s1c1
Sequence:CCGGGCCCAGTCTGAGTATCTAAATCTCGAGATTTAGATACTCAGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-781s1c1
Sequence:CCGGCCCACTTGATATGAAGCAGATCTCGAGATCTGCTTCATATCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-816s1c1
Sequence:CCGGCCACAGTTATTGCAGAGGAAACTCGAGTTTCCTCTGCAATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-739s1c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027992.1-1447s1c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027992.1-785s1c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-274s1c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-882s21c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027992.3-1546s21c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-371s21c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.3-967s1c1
Sequence:CCGGCCATCAAAGTGCACAACATAGCTCGAGCTATGTTGTGCACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-836s21c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027992
VALIDATED
TMEM106B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-1001s1c1
Sequence:CCGGGCCCAGTCTGAGTATCTAAATCTCGAGATTTAGATACTCAGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-781s1c1
Sequence:CCGGCCCACTTGATATGAAGCAGATCTCGAGATCTGCTTCATATCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-816s1c1
Sequence:CCGGCCACAGTTATTGCAGAGGAAACTCGAGTTTCCTCTGCAATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-739s1c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027992.1-1447s1c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027992.1-785s1c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-274s1c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-882s21c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027992.3-1546s21c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-371s21c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.3-967s1c1
Sequence:CCGGCCATCAAAGTGCACAACATAGCTCGAGCTATGTTGTGCACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-836s21c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027992
VALIDATED
TMEM106B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-1001s1c1
Sequence:CCGGGCCCAGTCTGAGTATCTAAATCTCGAGATTTAGATACTCAGACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.1-781s1c1
Sequence:CCGGCCCACTTGATATGAAGCAGATCTCGAGATCTGCTTCATATCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-816s1c1
Sequence:CCGGCCACAGTTATTGCAGAGGAAACTCGAGTTTCCTCTGCAATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-739s1c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027992.1-1447s1c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027992.1-785s1c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027992.1-274s1c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-882s21c1
Sequence:CCGGCTTGATATGAAGCAGATTGATCTCGAGATCAATCTGCTTCATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027992.3-1546s21c1
Sequence:CCGGCCTATTATTCATGGAGAACTTCTCGAGAAGTTCTCCATGAATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-371s21c1
Sequence:CCGGCGTTACATCGACAGACAATATCTCGAGATATTGTCTGTCGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027992.3-967s1c1
Sequence:CCGGCCATCAAAGTGCACAACATAGCTCGAGCTATGTTGTGCACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027992.3-836s21c1
Sequence:CCGGCGTGATTGGAAAGGCTCGTTTCTCGAGAAACGAGCCTTTCCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018374
VALIDATED
TMEM106B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018374.2-1599s1c1
Sequence:CCGGCCCATTGTTATATGGTAGTATCTCGAGATACTACCATATAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-921s1c1
Sequence:CCGGCTACCGTTATAGCAGAGGAAACTCGAGTTTCCTCTGCTATAACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-920s1c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-686s1c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-876s1c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-728s1c1
Sequence:CCGGGATGTTCAGAAGCGTACAATTCTCGAGAATTGTACGCTTCTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-452s1c1
Sequence:CCGGGATGTCTCTCAGTTTCCATATCTCGAGATATGGAAACTGAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018374.2-3223s1c1
Sequence:CCGGCCTGTCCTCATGTCCCATTTACTCGAGTAAATGGGACATGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-925s21c1
Sequence:CCGGTATTGGAAAGGCACGCTTAAACTCGAGTTTAAGCGTGCCTTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-998s21c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-764s21c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-954s21c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018374.3-1295s21c1
Sequence:CCGGTTCCTAATAGGAGACCTTAAACTCGAGTTTAAGGTCTCCTATTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018374
VALIDATED
TMEM106B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018374.2-1599s1c1
Sequence:CCGGCCCATTGTTATATGGTAGTATCTCGAGATACTACCATATAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-921s1c1
Sequence:CCGGCTACCGTTATAGCAGAGGAAACTCGAGTTTCCTCTGCTATAACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-920s1c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-686s1c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-876s1c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-728s1c1
Sequence:CCGGGATGTTCAGAAGCGTACAATTCTCGAGAATTGTACGCTTCTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-452s1c1
Sequence:CCGGGATGTCTCTCAGTTTCCATATCTCGAGATATGGAAACTGAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018374.2-3223s1c1
Sequence:CCGGCCTGTCCTCATGTCCCATTTACTCGAGTAAATGGGACATGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-925s21c1
Sequence:CCGGTATTGGAAAGGCACGCTTAAACTCGAGTTTAAGCGTGCCTTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-998s21c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-764s21c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-954s21c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018374.3-1295s21c1
Sequence:CCGGTTCCTAATAGGAGACCTTAAACTCGAGTTTAAGGTCTCCTATTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018374
VALIDATED
TMEM106B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018374.2-1599s1c1
Sequence:CCGGCCCATTGTTATATGGTAGTATCTCGAGATACTACCATATAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-921s1c1
Sequence:CCGGCTACCGTTATAGCAGAGGAAACTCGAGTTTCCTCTGCTATAACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-920s1c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-686s1c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018374.2-876s1c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-728s1c1
Sequence:CCGGGATGTTCAGAAGCGTACAATTCTCGAGAATTGTACGCTTCTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018374.2-452s1c1
Sequence:CCGGGATGTCTCTCAGTTTCCATATCTCGAGATATGGAAACTGAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018374.2-3223s1c1
Sequence:CCGGCCTGTCCTCATGTCCCATTTACTCGAGTAAATGGGACATGAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-925s21c1
Sequence:CCGGTATTGGAAAGGCACGCTTAAACTCGAGTTTAAGCGTGCCTTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-998s21c1
Sequence:CCGGCCTACCGTTATAGCAGAGGAACTCGAGTTCCTCTGCTATAACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-764s21c1
Sequence:CCGGGACGTGAAATACATTGGTGTACTCGAGTACACCAATGTATTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018374.3-954s21c1
Sequence:CCGGCCATTATTGGTCCACTTGATACTCGAGTATCAAGTGGACCAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018374.3-1295s21c1
Sequence:CCGGTTCCTAATAGGAGACCTTAAACTCGAGTTTAAGGTCTCCTATTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks