EMAIL THIS PAGE TO A FRIEND

TMEM106C

transmembrane protein 106C

UniProtKB ID: Q9BVX2, B2R998, B7Z5M4, Q3B761
Gene ID:
Mouse(380967) transmembrane protein 106C
Rat(315286) transmembrane protein 106C
chicken(426186) transmembrane protein 106C
domestic cat(101085901) transmembrane protein 106C
dog(477630) transmembrane protein 106C
domestic guinea pig(100734375) transmembrane protein 106C
naked mole-rat(101708277) transmembrane protein 106C
cow(514271) transmembrane protein 106C
sheep(101109162) transmembrane protein 106C
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024056 Rosetta Predictions human pricing
NM_001008358 Rosetta Predictions rat pricing
NM_201359 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203015 predicted 522
2 SASI_Hs01_00203016 predicted 203
3 SASI_Hs01_00203017 predicted 250
4 SASI_Hs01_00203018 predicted 533
5 SASI_Hs01_00203019 predicted 523
6 SASI_Hs02_00356509 predicted 517
7 SASI_Hs01_00203020 predicted 667
8 SASI_Hs02_00356510 predicted 429
9 SASI_Hs01_00203022 predicted 641
10 SASI_Hs01_00203023 predicted 362
11 SASI_Hs01_00203014 predicted 740
12 SASI_Hs01_00203021 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037388 predicted 425
2 SASI_Rn02_00199120 predicted 1161
3 SASI_Rn01_00037390 predicted 583
4 SASI_Rn01_00037392 predicted 333
5 SASI_Rn02_00199121 predicted 994
6 SASI_Rn01_00037394 predicted 415
7 SASI_Rn01_00037395 predicted 1050
8 SASI_Rn02_00199122 predicted 251
9 SASI_Rn01_00037396 predicted 267
10 SASI_Rn01_00037397 predicted 817
11 SASI_Rn01_00037389 predicted 737
12 SASI_Rn01_00037391 predicted 543
13 SASI_Rn01_00037393 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149901 predicted 1148
2 SASI_Mm02_00351516 predicted 349
3 SASI_Mm01_00149902 predicted 1040
4 SASI_Mm01_00149903 predicted 887
5 SASI_Mm01_00149904 predicted 1049
6 SASI_Mm01_00149905 predicted 1048
7 SASI_Mm01_00149906 predicted 1177
8 SASI_Mm01_00149907 predicted 1163
9 SASI_Mm02_00351517 predicted 1193
10 SASI_Mm01_00149908 predicted 882
11 SASI_Mm01_00149909 predicted 407
12 SASI_Mm01_00149910 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201359
VALIDATED
TMEM106C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-567s21c1
Sequence:CCGGTGGACGATAACGGCATCAAAGCTCGAGCTTTGATGCCGTTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-900s21c1
Sequence:CCGGTTTCATACATTGGCCACATATCTCGAGATATGTGGCCAATGTATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-769s21c1
Sequence:CCGGGAGTGAGCACCTGGTGAATTTCTCGAGAAATTCACCAGGTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201359.1-1156s21c1
Sequence:CCGGCCTAGTCTGTGCCTAGCAAATCTCGAGATTTGCTAGGCACAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-741s21c1
Sequence:CCGGCCACGAATGTCTCACTCATTGCTCGAGCAATGAGTGAGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201359.1-1454s1c1
Sequence:CCGGCCATACAAAGTGATTACAGTTCTCGAGAACTGTAATCACTTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-935s1c1
Sequence:CCGGGAGACACAGCACTATGTGGATCTCGAGATCCACATAGTGCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-646s1c1
Sequence:CCGGCCTGAAGATCAGGAACTCCAACTCGAGTTGGAGTTCCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201359
VALIDATED
TMEM106C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-567s21c1
Sequence:CCGGTGGACGATAACGGCATCAAAGCTCGAGCTTTGATGCCGTTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-900s21c1
Sequence:CCGGTTTCATACATTGGCCACATATCTCGAGATATGTGGCCAATGTATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-769s21c1
Sequence:CCGGGAGTGAGCACCTGGTGAATTTCTCGAGAAATTCACCAGGTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201359.1-1156s21c1
Sequence:CCGGCCTAGTCTGTGCCTAGCAAATCTCGAGATTTGCTAGGCACAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-741s21c1
Sequence:CCGGCCACGAATGTCTCACTCATTGCTCGAGCAATGAGTGAGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201359.1-1454s1c1
Sequence:CCGGCCATACAAAGTGATTACAGTTCTCGAGAACTGTAATCACTTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-935s1c1
Sequence:CCGGGAGACACAGCACTATGTGGATCTCGAGATCCACATAGTGCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-646s1c1
Sequence:CCGGCCTGAAGATCAGGAACTCCAACTCGAGTTGGAGTTCCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201359
VALIDATED
TMEM106C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-567s21c1
Sequence:CCGGTGGACGATAACGGCATCAAAGCTCGAGCTTTGATGCCGTTATCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-900s21c1
Sequence:CCGGTTTCATACATTGGCCACATATCTCGAGATATGTGGCCAATGTATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-769s21c1
Sequence:CCGGGAGTGAGCACCTGGTGAATTTCTCGAGAAATTCACCAGGTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201359.1-1156s21c1
Sequence:CCGGCCTAGTCTGTGCCTAGCAAATCTCGAGATTTGCTAGGCACAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_201359.1-741s21c1
Sequence:CCGGCCACGAATGTCTCACTCATTGCTCGAGCAATGAGTGAGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201359.1-1454s1c1
Sequence:CCGGCCATACAAAGTGATTACAGTTCTCGAGAACTGTAATCACTTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-935s1c1
Sequence:CCGGGAGACACAGCACTATGTGGATCTCGAGATCCACATAGTGCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201359.1-646s1c1
Sequence:CCGGCCTGAAGATCAGGAACTCCAACTCGAGTTGGAGTTCCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024056
VALIDATED
TMEM106C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 106C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-880s1c1
Sequence:CCGGGAGGAGGAATTGGTTCACTTACTCGAGTAAGTGAACCAATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-418s1c1
Sequence:CCGGCCTTGTAATTCTCACCATCATCTCGAGATGATGGTGAGAATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-961s1c1
Sequence:CCGGGTTTCTCAGAACCAGCAGAATCTCGAGATTCTGCTGGTTCTGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-536s1c1
Sequence:CCGGGTGACTACTAACGTCTCCCTTCTCGAGAAGGGAGACGTTAGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-679s1c1
Sequence:CCGGCATGCGAACTTCAGTGAAGATCTCGAGATCTTCACTGAAGTTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-374s1c1
Sequence:CCGGGACGGCATCAAAGTGGTGAAACTCGAGTTTCACCACTTTGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-498s1c1
Sequence:CCGGGCCAGATTCAGTACATGAACACTCGAGTGTTCATGTACTGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-697s1c1
Sequence:CCGGGATTTCATACATTGGCCTCATCTCGAGATGAGGCCAATGTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-1196s1c1
Sequence:CCGGCCATCCAAATACCTAAGAGAACTCGAGTTCTCTTAGGTATTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024056
VALIDATED
TMEM106C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 106C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-880s1c1
Sequence:CCGGGAGGAGGAATTGGTTCACTTACTCGAGTAAGTGAACCAATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-418s1c1
Sequence:CCGGCCTTGTAATTCTCACCATCATCTCGAGATGATGGTGAGAATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-961s1c1
Sequence:CCGGGTTTCTCAGAACCAGCAGAATCTCGAGATTCTGCTGGTTCTGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-536s1c1
Sequence:CCGGGTGACTACTAACGTCTCCCTTCTCGAGAAGGGAGACGTTAGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-679s1c1
Sequence:CCGGCATGCGAACTTCAGTGAAGATCTCGAGATCTTCACTGAAGTTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-374s1c1
Sequence:CCGGGACGGCATCAAAGTGGTGAAACTCGAGTTTCACCACTTTGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-498s1c1
Sequence:CCGGGCCAGATTCAGTACATGAACACTCGAGTGTTCATGTACTGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-697s1c1
Sequence:CCGGGATTTCATACATTGGCCTCATCTCGAGATGAGGCCAATGTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-1196s1c1
Sequence:CCGGCCATCCAAATACCTAAGAGAACTCGAGTTCTCTTAGGTATTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024056
VALIDATED
TMEM106C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 106C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-880s1c1
Sequence:CCGGGAGGAGGAATTGGTTCACTTACTCGAGTAAGTGAACCAATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-418s1c1
Sequence:CCGGCCTTGTAATTCTCACCATCATCTCGAGATGATGGTGAGAATTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-961s1c1
Sequence:CCGGGTTTCTCAGAACCAGCAGAATCTCGAGATTCTGCTGGTTCTGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-536s1c1
Sequence:CCGGGTGACTACTAACGTCTCCCTTCTCGAGAAGGGAGACGTTAGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-679s1c1
Sequence:CCGGCATGCGAACTTCAGTGAAGATCTCGAGATCTTCACTGAAGTTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-374s1c1
Sequence:CCGGGACGGCATCAAAGTGGTGAAACTCGAGTTTCACCACTTTGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-498s1c1
Sequence:CCGGGCCAGATTCAGTACATGAACACTCGAGTGTTCATGTACTGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024056.2-697s1c1
Sequence:CCGGGATTTCATACATTGGCCTCATCTCGAGATGAGGCCAATGTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024056.2-1196s1c1
Sequence:CCGGCCATCCAAATACCTAAGAGAACTCGAGTTCTCTTAGGTATTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks