EMAIL THIS PAGE TO A FRIEND

TMEM107

transmembrane protein 107

Synonyms: GRVS638 PRO1268
UniProtKB ID: Q6UX40, A0PJV7, Q6NSE3, Q6ZRX9, Q96T82
Gene ID:
Mouse(66910) transmembrane protein 107
Rat(691750) transmembrane protein 107
cow(509812) transmembrane protein 107
sheep(101106184) transmembrane protein 107
naked mole-rat(101712200) transmembrane protein 107
domestic guinea pig(100730895) transmembrane protein 107
Zebrafish(406492) transmembrane protein 107
domestic cat(101080838) transmembrane protein 107
dog(608105) transmembrane protein 107
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032354 Rosetta Predictions human pricing
NM_183065 Rosetta Predictions human pricing
NM_001109648 Rosetta Predictions rat pricing
NM_025838 Rosetta Predictions mouse pricing
NM_028336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240576 predicted 566
2 SASI_Hs01_00240577 predicted 490
3 SASI_Hs01_00240578 predicted 553
4 SASI_Hs01_00240579 predicted 496
5 SASI_Hs01_00240580 predicted 478
6 SASI_Hs01_00240581 predicted 489
7 SASI_Hs01_00240582 predicted 539
8 SASI_Hs01_00240583 predicted 560
9 SASI_Hs01_00240584 predicted 491
10 SASI_Hs01_00240585 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047798 predicted 540
2 SASI_Hs01_00047799 predicted 467
3 SASI_Hs01_00047800 predicted 537
4 SASI_Hs01_00047801 predicted 479
5 SASI_Hs01_00047802 predicted 457
6 SASI_Hs01_00047803 predicted 478
7 SASI_Hs01_00047804 predicted 519
8 SASI_Hs01_00047805 predicted 540
9 SASI_Hs01_00047806 predicted 467
10 SASI_Hs01_00047807 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250412 predicted 406
2 SASI_Rn02_00250413 predicted 770
3 SASI_Rn02_00250414 predicted 502
4 SASI_Rn02_00250415 predicted 703
5 SASI_Rn02_00250416 predicted 414
6 SASI_Rn02_00250417 predicted 682
7 SASI_Rn02_00250418 predicted 788
8 SASI_Rn02_00250419 predicted 439
9 SASI_Rn02_00250420 predicted 434
10 SASI_Rn02_00250421 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068635 predicted 493
2 SASI_Mm01_00068636 predicted 402
3 SASI_Mm01_00068637 predicted 438
4 SASI_Mm01_00068638 predicted 287
5 SASI_Mm01_00068639 predicted 508
6 SASI_Mm01_00068640 predicted 405
7 SASI_Mm01_00068641 predicted 201
8 SASI_Mm02_00329114 predicted 340
9 SASI_Mm01_00068642 predicted 449
10 SASI_Mm01_00068643 predicted 432
11 SASI_Mm01_00068634 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201140 predicted 929
2 SASI_Mm01_00201142 predicted 939
3 SASI_Mm01_00201143 predicted 907
4 SASI_Mm01_00201144 predicted 931
5 SASI_Mm01_00201145 predicted 238
6 SASI_Mm01_00201146 predicted 1032
7 SASI_Mm01_00201147 predicted 925
8 SASI_Mm01_00201148 predicted 1031
9 SASI_Mm01_00201149 predicted 897
10 SASI_Mm02_00333710 predicted 204
11 SASI_Mm01_00201141 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032354
VALIDATED
TMEM107 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 107
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-248s1c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-428s1c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-510s1c1
Sequence:CCGGGCTTTATTCGTCACCGTCTTTCTCGAGAAAGACGGTGACGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032354.2-495s1c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-1113s1c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-424s1c1
Sequence:CCGGCCTTCTTCATATTCGAGCGTTCTCGAGAACGCTCGAATATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-419s1c1
Sequence:CCGGCCTGTCCTTCTTCATATTCGACTCGAGTCGAATATGAAGAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-425s21c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032354.3-1110s21c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-492s21c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-245s21c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032354
VALIDATED
TMEM107 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 107
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-248s1c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-428s1c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-510s1c1
Sequence:CCGGGCTTTATTCGTCACCGTCTTTCTCGAGAAAGACGGTGACGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032354.2-495s1c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-1113s1c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-424s1c1
Sequence:CCGGCCTTCTTCATATTCGAGCGTTCTCGAGAACGCTCGAATATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-419s1c1
Sequence:CCGGCCTGTCCTTCTTCATATTCGACTCGAGTCGAATATGAAGAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-425s21c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032354.3-1110s21c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-492s21c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-245s21c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032354
VALIDATED
TMEM107 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 107
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-248s1c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-428s1c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-510s1c1
Sequence:CCGGGCTTTATTCGTCACCGTCTTTCTCGAGAAAGACGGTGACGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032354.2-495s1c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032354.2-1113s1c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-424s1c1
Sequence:CCGGCCTTCTTCATATTCGAGCGTTCTCGAGAACGCTCGAATATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032354.2-419s1c1
Sequence:CCGGCCTGTCCTTCTTCATATTCGACTCGAGTCGAATATGAAGAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-425s21c1
Sequence:CCGGCTTCATATTCGAGCGTTGGGACTCGAGTCCCAACGCTCGAATATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032354.3-1110s21c1
Sequence:CCGGCCTAGCTTGTAACGGAATCTTCTCGAGAAGATTCCGTTACAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-492s21c1
Sequence:CCGGGCTGTCACTGAAATGGCTTTACTCGAGTAAAGCCATTTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032354.3-245s21c1
Sequence:CCGGGTATGACAAGCAGGACATTCACTCGAGTGAATGTCCTGCTTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025838
TMEM107 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 107
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-545s21c1
Sequence:CCGGGAAACCCTTCTGATCACAATCCTCGAGGATTGTGATCAGAAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025838.1-570s21c1
Sequence:CCGGTGTAGGGACCAAGGCTGGAAACTCGAGTTTCCAGCCTTGGTCCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-500s21c1
Sequence:CCGGTGTCACTGAAACTGCATTATTCTCGAGAATAATGCAGTTTCAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-191s21c1
Sequence:CCGGGGTGGTTGTCATCACGTTGTTCTCGAGAACAACGTGATGACAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-236s21c1
Sequence:CCGGGGCTTGCCTGCCTCTCAAATTCTCGAGAATTTGAGAGGCAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025838
TMEM107 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 107
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-545s21c1
Sequence:CCGGGAAACCCTTCTGATCACAATCCTCGAGGATTGTGATCAGAAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025838.1-570s21c1
Sequence:CCGGTGTAGGGACCAAGGCTGGAAACTCGAGTTTCCAGCCTTGGTCCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-500s21c1
Sequence:CCGGTGTCACTGAAACTGCATTATTCTCGAGAATAATGCAGTTTCAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-191s21c1
Sequence:CCGGGGTGGTTGTCATCACGTTGTTCTCGAGAACAACGTGATGACAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-236s21c1
Sequence:CCGGGGCTTGCCTGCCTCTCAAATTCTCGAGAATTTGAGAGGCAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025838
TMEM107 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 107
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-545s21c1
Sequence:CCGGGAAACCCTTCTGATCACAATCCTCGAGGATTGTGATCAGAAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025838.1-570s21c1
Sequence:CCGGTGTAGGGACCAAGGCTGGAAACTCGAGTTTCCAGCCTTGGTCCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-500s21c1
Sequence:CCGGTGTCACTGAAACTGCATTATTCTCGAGAATAATGCAGTTTCAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-191s21c1
Sequence:CCGGGGTGGTTGTCATCACGTTGTTCTCGAGAACAACGTGATGACAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025838.1-236s21c1
Sequence:CCGGGGCTTGCCTGCCTCTCAAATTCTCGAGAATTTGAGAGGCAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks