EMAIL THIS PAGE TO A FRIEND

TMEM108

transmembrane protein 108

Synonyms: CT124
UniProtKB ID: Q6UXF1, D3DNC9, Q9BQH1, Q9BW81, Q9C0H3
Gene ID:
Mouse(81907) transmembrane protein 108
Rat(300967) transmembrane protein 108
chicken(420692) transmembrane protein 108
dog(485667) transmembrane protein 108
domestic cat(101088102) transmembrane protein 108
domestic guinea pig(100720906) transmembrane protein 108
naked mole-rat(101714067) transmembrane protein 108
sheep(101115599) transmembrane protein 108
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023943 Rosetta Predictions human pricing
XM_001069716 Rosetta Predictions rat pricing
XM_001069755 Rosetta Predictions rat pricing
XM_217247 Rosetta Predictions rat pricing
NM_178638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142561 predicted 347
2 SASI_Hs01_00142562 predicted 1720
3 SASI_Hs01_00142563 predicted 204
4 SASI_Hs01_00142564 predicted 1058
5 SASI_Hs01_00142565 predicted 1178
6 SASI_Hs01_00142566 predicted 1375
7 SASI_Hs01_00142567 predicted 1465
8 SASI_Hs01_00142568 predicted 295
9 SASI_Hs01_00142569 predicted 1397
10 SASI_Hs01_00142570 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329021 predicted 886
2 SASI_Rn02_00329022 predicted 941
3 SASI_Rn02_00329023 predicted 1089
4 SASI_Rn02_00329024 predicted 1393
5 SASI_Rn02_00329025 predicted 235
6 SASI_Rn02_00329026 predicted 1127
7 SASI_Rn02_00329027 predicted 318
8 SASI_Rn02_00329028 predicted 1454
9 SASI_Rn02_00329029 predicted 1307
10 SASI_Rn02_00329030 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329163 predicted 989
2 SASI_Rn02_00329164 predicted 1053
3 SASI_Rn02_00329165 predicted 1203
4 SASI_Rn02_00329166 predicted 1507
5 SASI_Rn02_00329167 predicted 1236
6 SASI_Rn02_00329168 predicted 1567
7 SASI_Rn02_00329169 predicted 1423
8 SASI_Rn02_00329170 predicted 452
9 SASI_Rn02_00329171 predicted 676
10 SASI_Rn02_00329172 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377090 predicted 880
2 SASI_Rn02_00377091 predicted 937
3 SASI_Rn02_00377092 predicted 1084
4 SASI_Rn02_00377093 predicted 882
5 SASI_Rn02_00377094 predicted 235
6 SASI_Rn02_00377095 predicted 1127
7 SASI_Rn02_00377096 predicted 313
8 SASI_Rn02_00377097 predicted 966
9 SASI_Rn02_00377098 predicted 661
10 SASI_Rn02_00377099 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122723 predicted 237
2 SASI_Mm01_00122725 predicted 1725
3 SASI_Mm01_00122726 predicted 389
4 SASI_Mm01_00122727 predicted 278
5 SASI_Mm01_00122728 predicted 619
6 SASI_Mm01_00122729 predicted 949
7 SASI_Mm01_00122730 predicted 251
8 SASI_Mm01_00122731 predicted 480
9 SASI_Mm01_00122732 predicted 1473
10 SASI_Mm02_00349026 predicted 1011
11 SASI_Mm01_00122724 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023943
TMEM108 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 108
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-1899s1c1
Sequence:CCGGCGATCAAGTATCTGAGATCTACTCGAGTAGATCTCAGATACTTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1869s1c1
Sequence:CCGGCTTCTGTCAAGAAACACTGTTCTCGAGAACAGTGTTTCTTGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2002s1c1
Sequence:CCGGCTTTGTGTAACCCTGACTTAACTCGAGTTAAGTCAGGGTTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1868s1c1
Sequence:CCGGCCTTCTGTCAAGAAACACTGTCTCGAGACAGTGTTTCTTGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1713s1c1
Sequence:CCGGCTGGAACAACACCATCACCATCTCGAGATGGTGATGGTGTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1701s1c1
Sequence:CCGGCAACCTGAGCTACTGGAACAACTCGAGTTGTTCCAGTAGCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-269s1c1
Sequence:CCGGCATTTGCCATCCAGGAACCATCTCGAGATGGTTCCTGGATGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-365s1c1
Sequence:CCGGCCAGACATACTTCTGTGGTGACTCGAGTCACCACAGAAGTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023943.1-1930s1c1
Sequence:CCGGGCATCACTTTGCCATTCCGTACTCGAGTACGGAATGGCAAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-840s1c1
Sequence:CCGGCTTTCAGATCTACAAGGGCAACTCGAGTTGCCCTTGTAGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2001s1c1
Sequence:CCGGCCTTTGTGTAACCCTGACTTACTCGAGTAAGTCAGGGTTACACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023943
TMEM108 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 108
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-1899s1c1
Sequence:CCGGCGATCAAGTATCTGAGATCTACTCGAGTAGATCTCAGATACTTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1869s1c1
Sequence:CCGGCTTCTGTCAAGAAACACTGTTCTCGAGAACAGTGTTTCTTGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2002s1c1
Sequence:CCGGCTTTGTGTAACCCTGACTTAACTCGAGTTAAGTCAGGGTTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1868s1c1
Sequence:CCGGCCTTCTGTCAAGAAACACTGTCTCGAGACAGTGTTTCTTGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1713s1c1
Sequence:CCGGCTGGAACAACACCATCACCATCTCGAGATGGTGATGGTGTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1701s1c1
Sequence:CCGGCAACCTGAGCTACTGGAACAACTCGAGTTGTTCCAGTAGCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-269s1c1
Sequence:CCGGCATTTGCCATCCAGGAACCATCTCGAGATGGTTCCTGGATGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-365s1c1
Sequence:CCGGCCAGACATACTTCTGTGGTGACTCGAGTCACCACAGAAGTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023943.1-1930s1c1
Sequence:CCGGGCATCACTTTGCCATTCCGTACTCGAGTACGGAATGGCAAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-840s1c1
Sequence:CCGGCTTTCAGATCTACAAGGGCAACTCGAGTTGCCCTTGTAGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2001s1c1
Sequence:CCGGCCTTTGTGTAACCCTGACTTACTCGAGTAAGTCAGGGTTACACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023943
TMEM108 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 108
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-1899s1c1
Sequence:CCGGCGATCAAGTATCTGAGATCTACTCGAGTAGATCTCAGATACTTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1869s1c1
Sequence:CCGGCTTCTGTCAAGAAACACTGTTCTCGAGAACAGTGTTTCTTGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2002s1c1
Sequence:CCGGCTTTGTGTAACCCTGACTTAACTCGAGTTAAGTCAGGGTTACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1868s1c1
Sequence:CCGGCCTTCTGTCAAGAAACACTGTCTCGAGACAGTGTTTCTTGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1713s1c1
Sequence:CCGGCTGGAACAACACCATCACCATCTCGAGATGGTGATGGTGTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023943.1-1701s1c1
Sequence:CCGGCAACCTGAGCTACTGGAACAACTCGAGTTGTTCCAGTAGCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-269s1c1
Sequence:CCGGCATTTGCCATCCAGGAACCATCTCGAGATGGTTCCTGGATGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-365s1c1
Sequence:CCGGCCAGACATACTTCTGTGGTGACTCGAGTCACCACAGAAGTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023943.1-1930s1c1
Sequence:CCGGGCATCACTTTGCCATTCCGTACTCGAGTACGGAATGGCAAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023943.1-840s1c1
Sequence:CCGGCTTTCAGATCTACAAGGGCAACTCGAGTTGCCCTTGTAGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023943.1-2001s1c1
Sequence:CCGGCCTTTGTGTAACCCTGACTTACTCGAGTAAGTCAGGGTTACACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178638
TMEM108 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 108
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1708s1c1
Sequence:CCGGGAACAACCTGAGCTACTGGAACTCGAGTTCCAGTAGCTCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-853s1c1
Sequence:CCGGCTTCCAAATCTACAAGGGTAACTCGAGTTACCCTTGTAGATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1734s1c1
Sequence:CCGGCCATCACAATGGACTACTTCACTCGAGTGAAGTAGTCCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-440s1c1
Sequence:CCGGGCTACTCTGGAAACTACAGTACTCGAGTACTGTAGTTTCCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1036s1c1
Sequence:CCGGGCCAGGCTTTATCAGATCCAACTCGAGTTGGATCTGATAAAGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178638
TMEM108 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 108
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1708s1c1
Sequence:CCGGGAACAACCTGAGCTACTGGAACTCGAGTTCCAGTAGCTCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-853s1c1
Sequence:CCGGCTTCCAAATCTACAAGGGTAACTCGAGTTACCCTTGTAGATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1734s1c1
Sequence:CCGGCCATCACAATGGACTACTTCACTCGAGTGAAGTAGTCCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-440s1c1
Sequence:CCGGGCTACTCTGGAAACTACAGTACTCGAGTACTGTAGTTTCCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1036s1c1
Sequence:CCGGGCCAGGCTTTATCAGATCCAACTCGAGTTGGATCTGATAAAGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178638
TMEM108 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 108
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1708s1c1
Sequence:CCGGGAACAACCTGAGCTACTGGAACTCGAGTTCCAGTAGCTCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-853s1c1
Sequence:CCGGCTTCCAAATCTACAAGGGTAACTCGAGTTACCCTTGTAGATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1734s1c1
Sequence:CCGGCCATCACAATGGACTACTTCACTCGAGTGAAGTAGTCCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-440s1c1
Sequence:CCGGGCTACTCTGGAAACTACAGTACTCGAGTACTGTAGTTTCCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178638.2-1036s1c1
Sequence:CCGGGCCAGGCTTTATCAGATCCAACTCGAGTTGGATCTGATAAAGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks