EMAIL THIS PAGE TO A FRIEND

TMEM109

transmembrane protein 109

UniProtKB ID: Q9BVC6
Gene ID:
Mouse(68539) transmembrane protein 109
Rat(361732) transmembrane protein 109
cow(540138) transmembrane protein 109
sheep(101121813) transmembrane protein 109
naked mole-rat(101720458) transmembrane protein 109
Domestic Rabbit(100008604) transmembrane protein 109
domestic guinea pig(100721972) transmembrane protein 109
dog(612355) transmembrane protein 109
domestic cat(101080574) transmembrane protein 109
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011785 Anti-TMEM109 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV49804 Anti-TMEM109 antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, bovine, human, rabbit, rabbit, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024092 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024092 Rosetta Predictions human pricing
NM_001007736 Rosetta Predictions rat pricing
NM_134142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174149 predicted 1194
2 SASI_Hs01_00174150 predicted 325
3 SASI_Hs01_00174151 predicted 286
4 SASI_Hs01_00174152 predicted 556
5 SASI_Hs01_00174153 predicted 806
6 SASI_Hs01_00174154 predicted 1184
7 SASI_Hs02_00356572 predicted 1091
8 SASI_Hs02_00356573 predicted 974
9 SASI_Hs01_00174155 predicted 255
10 SASI_Hs01_00174156 predicted 481
11 SASI_Hs01_00174157 predicted 1117
12 SASI_Hs01_00174158 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070627 predicted 1300
2 SASI_Rn01_00070628 predicted 234
3 SASI_Rn01_00070630 predicted 974
4 SASI_Rn01_00070631 predicted 795
5 SASI_Rn01_00070632 predicted 479
6 SASI_Rn01_00070633 predicted 214
7 SASI_Rn01_00070634 predicted 784
8 SASI_Rn01_00070635 predicted 425
9 SASI_Rn01_00070636 predicted 1192
10 SASI_Rn02_00198925 predicted 700
11 SASI_Rn01_00070629 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090392 predicted 209
2 SASI_Mm01_00090393 predicted 220
3 SASI_Mm01_00090394 predicted 261
4 SASI_Mm01_00090395 predicted 357
5 SASI_Mm01_00090396 predicted 259
6 SASI_Mm01_00090397 predicted 507
7 SASI_Mm01_00090398 predicted 308
8 SASI_Mm01_00090400 predicted 923
9 SASI_Mm01_00090401 predicted 354
10 SASI_Mm02_00339411 predicted 517
11 SASI_Mm01_00090399 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134142
VALIDATED
TMEM109 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 109
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134142.1-328s1c1
Sequence:CCGGGATTTCAGAGACCCTGTTGCACTCGAGTGCAACAGGGTCTCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-760s21c1
Sequence:CCGGGCGCCAGATAGAAGAGCTTAGCTCGAGCTAAGCTCTTCTATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-1112s21c1
Sequence:CCGGCGCTGATCTCCGTGATGATTACTCGAGTAATCATCACGGAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-198s21c1
Sequence:CCGGCCCAGTCTCATCGAGAGTTTGCTCGAGCAAACTCTCGATGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-660s21c1
Sequence:CCGGTGATGCTCTTGGCCTTGTTAACTCGAGTTAACAAGGCCAAGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134142
VALIDATED
TMEM109 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 109
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134142.1-328s1c1
Sequence:CCGGGATTTCAGAGACCCTGTTGCACTCGAGTGCAACAGGGTCTCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-760s21c1
Sequence:CCGGGCGCCAGATAGAAGAGCTTAGCTCGAGCTAAGCTCTTCTATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-1112s21c1
Sequence:CCGGCGCTGATCTCCGTGATGATTACTCGAGTAATCATCACGGAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-198s21c1
Sequence:CCGGCCCAGTCTCATCGAGAGTTTGCTCGAGCAAACTCTCGATGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-660s21c1
Sequence:CCGGTGATGCTCTTGGCCTTGTTAACTCGAGTTAACAAGGCCAAGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134142
VALIDATED
TMEM109 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 109
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134142.1-328s1c1
Sequence:CCGGGATTTCAGAGACCCTGTTGCACTCGAGTGCAACAGGGTCTCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-760s21c1
Sequence:CCGGGCGCCAGATAGAAGAGCTTAGCTCGAGCTAAGCTCTTCTATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-1112s21c1
Sequence:CCGGCGCTGATCTCCGTGATGATTACTCGAGTAATCATCACGGAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-198s21c1
Sequence:CCGGCCCAGTCTCATCGAGAGTTTGCTCGAGCAAACTCTCGATGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_134142.1-660s21c1
Sequence:CCGGTGATGCTCTTGGCCTTGTTAACTCGAGTTAACAAGGCCAAGAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024092
VALIDATED
TMEM109 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 109
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-178s1c1
Sequence:CCGGCGTCGAGACTTTGCACCACCACTCGAGTGGTGGTGCAAAGTCTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-104s1c1
Sequence:CCGGGAAAGCATGTGTTCAAAGCCACTCGAGTGGCTTTGAACACATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-108s1c1
Sequence:CCGGGCATGTGTTCAAAGCCATTCTCTCGAGAGAATGGCTTTGAACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-226s1c1
Sequence:CCGGGATGTCTTGACCCAGATAGGTCTCGAGACCTATCTGGGTCAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-558s1c1
Sequence:CCGGCCTGAAGCTTGTCATCTTCCTCTCGAGAGGAAGATGACAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024092.1-399s1c1
Sequence:CCGGCTTGGGACTAGCTGGTGATTACTCGAGTAATCACCAGCTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-357s1c1
Sequence:CCGGCTTCTTTGCTCTGTCTGGGATCTCGAGATCCCAGACAGAGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024092.1-1122s1c1
Sequence:CCGGCGTTGGTCTCTCATGACTTAACTCGAGTTAAGTCATGAGAGACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1420s1c1
Sequence:CCGGGTCTCTTTCAAGTGCCTTAATCTCGAGATTAAGGCACTTGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1946s1c1
Sequence:CCGGCCAATTCTTACTGTTCAGGTTCTCGAGAACCTGAACAGTAAGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024092
VALIDATED
TMEM109 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 109
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-178s1c1
Sequence:CCGGCGTCGAGACTTTGCACCACCACTCGAGTGGTGGTGCAAAGTCTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-104s1c1
Sequence:CCGGGAAAGCATGTGTTCAAAGCCACTCGAGTGGCTTTGAACACATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-108s1c1
Sequence:CCGGGCATGTGTTCAAAGCCATTCTCTCGAGAGAATGGCTTTGAACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-226s1c1
Sequence:CCGGGATGTCTTGACCCAGATAGGTCTCGAGACCTATCTGGGTCAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-558s1c1
Sequence:CCGGCCTGAAGCTTGTCATCTTCCTCTCGAGAGGAAGATGACAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024092.1-399s1c1
Sequence:CCGGCTTGGGACTAGCTGGTGATTACTCGAGTAATCACCAGCTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-357s1c1
Sequence:CCGGCTTCTTTGCTCTGTCTGGGATCTCGAGATCCCAGACAGAGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024092.1-1122s1c1
Sequence:CCGGCGTTGGTCTCTCATGACTTAACTCGAGTTAAGTCATGAGAGACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1420s1c1
Sequence:CCGGGTCTCTTTCAAGTGCCTTAATCTCGAGATTAAGGCACTTGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1946s1c1
Sequence:CCGGCCAATTCTTACTGTTCAGGTTCTCGAGAACCTGAACAGTAAGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024092
VALIDATED
TMEM109 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 109
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-178s1c1
Sequence:CCGGCGTCGAGACTTTGCACCACCACTCGAGTGGTGGTGCAAAGTCTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-104s1c1
Sequence:CCGGGAAAGCATGTGTTCAAAGCCACTCGAGTGGCTTTGAACACATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-108s1c1
Sequence:CCGGGCATGTGTTCAAAGCCATTCTCTCGAGAGAATGGCTTTGAACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-226s1c1
Sequence:CCGGGATGTCTTGACCCAGATAGGTCTCGAGACCTATCTGGGTCAAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-558s1c1
Sequence:CCGGCCTGAAGCTTGTCATCTTCCTCTCGAGAGGAAGATGACAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024092.1-399s1c1
Sequence:CCGGCTTGGGACTAGCTGGTGATTACTCGAGTAATCACCAGCTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024092.1-357s1c1
Sequence:CCGGCTTCTTTGCTCTGTCTGGGATCTCGAGATCCCAGACAGAGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024092.1-1122s1c1
Sequence:CCGGCGTTGGTCTCTCATGACTTAACTCGAGTTAAGTCATGAGAGACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1420s1c1
Sequence:CCGGGTCTCTTTCAAGTGCCTTAATCTCGAGATTAAGGCACTTGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024092.1-1946s1c1
Sequence:CCGGCCAATTCTTACTGTTCAGGTTCTCGAGAACCTGAACAGTAAGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks