EMAIL THIS PAGE TO A FRIEND

TMEM110

transmembrane protein 110

UniProtKB ID: Q86TL2
Gene ID:
Mouse(69179) transmembrane protein 110
Rat(361110) transmembrane protein 110
cow(538654) transmembrane protein 110
sheep(101108428) transmembrane protein 110
naked mole-rat(101721093) transmembrane protein 110
domestic guinea pig(100726809) transmembrane protein 110
Zebrafish(393439) transmembrane protein 110
domestic cat(101087459) transmembrane protein 110
dog(608110) transmembrane protein 110-like
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198563 Rosetta Predictions human pricing
NM_198774 Rosetta Predictions rat pricing
NM_028839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204728 predicted 736
2 SASI_Hs01_00204729 predicted 378
3 SASI_Hs01_00204730 predicted 591
4 SASI_Hs02_00372182 predicted 1176
5 SASI_Hs02_00372183 predicted 743
6 SASI_Hs01_00204732 predicted 1242
7 SASI_Hs01_00204733 predicted 746
8 SASI_Hs01_00204735 predicted 542
9 SASI_Hs01_00204737 predicted 225
10 SASI_Hs02_00372184 predicted 329
11 SASI_Hs01_00204731 predicted 1216
12 SASI_Hs01_00204734 predicted 1189
13 SASI_Hs01_00204736 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072528 predicted 381
2 SASI_Rn01_00072529 predicted 747
3 SASI_Rn01_00072530 predicted 1373
4 SASI_Rn01_00072531 predicted 1167
5 SASI_Rn01_00072532 predicted 1152
6 SASI_Rn01_00072533 predicted 347
7 SASI_Rn01_00072534 predicted 548
8 SASI_Rn01_00072535 predicted 1072
9 SASI_Rn01_00072536 predicted 1362
10 SASI_Rn01_00072537 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334480 predicted 1378
2 SASI_Mm02_00334481 predicted 655
3 SASI_Mm02_00334482 predicted 687
4 SASI_Mm02_00334483 predicted 1385
5 SASI_Mm02_00334484 predicted 451
6 SASI_Mm02_00334485 predicted 801
7 SASI_Mm02_00334486 predicted 1397
8 SASI_Mm02_00334487 predicted 521
9 SASI_Mm02_00334488 predicted 1306
10 SASI_Mm02_00334489 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198563
VALIDATED
TMEM110 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 110
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-686s1c1
Sequence:CCGGCCTTCTTTGTCAACGCTTTGACTCGAGTCAAAGCGTTGACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198563.1-230s1c1
Sequence:CCGGGCACGTTAATGCTCAAACGCTCTCGAGAGCGTTTGAGCATTAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-837s1c1
Sequence:CCGGGTCTGAGTCTGAGATCCTGATCTCGAGATCAGGATCTCAGACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-247s1c1
Sequence:CCGGCGCTTCAGAGAACCAAAGCATCTCGAGATGCTTTGGTTCTCTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198563.1-546s1c1
Sequence:CCGGCGCTCTTTACATCGTGATCATCTCGAGATGATCACGATGTAAAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198563.1-1421s1c1
Sequence:CCGGCGGAATGCTTTCTTACTCAAACTCGAGTTTGAGTAAGAAAGCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-274s21c1
Sequence:CCGGCGTCCGTGGAGGATATGGTTTCTCGAGAAACCATATCCTCCACGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-320s21c1
Sequence:CCGGGAATGCTGTTCATCCACTTTGCTCGAGCAAAGTGGATGAACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1182s21c1
Sequence:CCGGCCATTCAGTTGCACTACAAACCTCGAGGTTTGTAGTGCAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-747s21c1
Sequence:CCGGGACGAAAGCTAAGCTAGAAGACTCGAGTCTTCTAGCTTAGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-545s21c1
Sequence:CCGGGCGCTCTTTACATCGTGATCACTCGAGTGATCACGATGTAAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1375s21c1
Sequence:CCGGACGTAACACCCTCGGGCTAAACTCGAGTTTAGCCCGAGGGTGTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198563
VALIDATED
TMEM110 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 110
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-686s1c1
Sequence:CCGGCCTTCTTTGTCAACGCTTTGACTCGAGTCAAAGCGTTGACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198563.1-230s1c1
Sequence:CCGGGCACGTTAATGCTCAAACGCTCTCGAGAGCGTTTGAGCATTAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-837s1c1
Sequence:CCGGGTCTGAGTCTGAGATCCTGATCTCGAGATCAGGATCTCAGACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-247s1c1
Sequence:CCGGCGCTTCAGAGAACCAAAGCATCTCGAGATGCTTTGGTTCTCTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198563.1-546s1c1
Sequence:CCGGCGCTCTTTACATCGTGATCATCTCGAGATGATCACGATGTAAAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198563.1-1421s1c1
Sequence:CCGGCGGAATGCTTTCTTACTCAAACTCGAGTTTGAGTAAGAAAGCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-274s21c1
Sequence:CCGGCGTCCGTGGAGGATATGGTTTCTCGAGAAACCATATCCTCCACGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-320s21c1
Sequence:CCGGGAATGCTGTTCATCCACTTTGCTCGAGCAAAGTGGATGAACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1182s21c1
Sequence:CCGGCCATTCAGTTGCACTACAAACCTCGAGGTTTGTAGTGCAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-747s21c1
Sequence:CCGGGACGAAAGCTAAGCTAGAAGACTCGAGTCTTCTAGCTTAGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-545s21c1
Sequence:CCGGGCGCTCTTTACATCGTGATCACTCGAGTGATCACGATGTAAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1375s21c1
Sequence:CCGGACGTAACACCCTCGGGCTAAACTCGAGTTTAGCCCGAGGGTGTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198563
VALIDATED
TMEM110 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 110
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-686s1c1
Sequence:CCGGCCTTCTTTGTCAACGCTTTGACTCGAGTCAAAGCGTTGACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198563.1-230s1c1
Sequence:CCGGGCACGTTAATGCTCAAACGCTCTCGAGAGCGTTTGAGCATTAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-837s1c1
Sequence:CCGGGTCTGAGTCTGAGATCCTGATCTCGAGATCAGGATCTCAGACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198563.1-247s1c1
Sequence:CCGGCGCTTCAGAGAACCAAAGCATCTCGAGATGCTTTGGTTCTCTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198563.1-546s1c1
Sequence:CCGGCGCTCTTTACATCGTGATCATCTCGAGATGATCACGATGTAAAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198563.1-1421s1c1
Sequence:CCGGCGGAATGCTTTCTTACTCAAACTCGAGTTTGAGTAAGAAAGCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-274s21c1
Sequence:CCGGCGTCCGTGGAGGATATGGTTTCTCGAGAAACCATATCCTCCACGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-320s21c1
Sequence:CCGGGAATGCTGTTCATCCACTTTGCTCGAGCAAAGTGGATGAACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1182s21c1
Sequence:CCGGCCATTCAGTTGCACTACAAACCTCGAGGTTTGTAGTGCAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-747s21c1
Sequence:CCGGGACGAAAGCTAAGCTAGAAGACTCGAGTCTTCTAGCTTAGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198563.1-545s21c1
Sequence:CCGGGCGCTCTTTACATCGTGATCACTCGAGTGATCACGATGTAAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198563.1-1375s21c1
Sequence:CCGGACGTAACACCCTCGGGCTAAACTCGAGTTTAGCCCGAGGGTGTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028839
VALIDATED
TMEM110 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 110
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-779s1c1
Sequence:CCGGGAAGACGAAAGCTAAACTAAACTCGAGTTTAGTTTAGCTTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-876s1c1
Sequence:CCGGGAGTCTGAGATCCTGATCTCACTCGAGTGAGATCAGGATCTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.3-452s1c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028839.3-1872s1c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-1872s21c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-417s21c1
Sequence:CCGGCACTGTACCTCATCAACTTTCCTCGAGGAAAGTTGATGAGGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-741s21c1
Sequence:CCGGTGTTCTGGGTAGTGGACAATTCTCGAGAATTGTCCACTACCCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-260s21c1
Sequence:CCGGTTCAGCACATTGATGCTTAAACTCGAGTTTAAGCATCAATGTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-452s21c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028839
VALIDATED
TMEM110 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 110
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-779s1c1
Sequence:CCGGGAAGACGAAAGCTAAACTAAACTCGAGTTTAGTTTAGCTTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-876s1c1
Sequence:CCGGGAGTCTGAGATCCTGATCTCACTCGAGTGAGATCAGGATCTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.3-452s1c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028839.3-1872s1c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-1872s21c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-417s21c1
Sequence:CCGGCACTGTACCTCATCAACTTTCCTCGAGGAAAGTTGATGAGGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-741s21c1
Sequence:CCGGTGTTCTGGGTAGTGGACAATTCTCGAGAATTGTCCACTACCCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-260s21c1
Sequence:CCGGTTCAGCACATTGATGCTTAAACTCGAGTTTAAGCATCAATGTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-452s21c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028839
VALIDATED
TMEM110 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 110
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-779s1c1
Sequence:CCGGGAAGACGAAAGCTAAACTAAACTCGAGTTTAGTTTAGCTTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.2-876s1c1
Sequence:CCGGGAGTCTGAGATCCTGATCTCACTCGAGTGAGATCAGGATCTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028839.3-452s1c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028839.3-1872s1c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-1872s21c1
Sequence:CCGGGTGTTGGAGGCAATGGTTAAACTCGAGTTTAACCATTGCCTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-417s21c1
Sequence:CCGGCACTGTACCTCATCAACTTTCCTCGAGGAAAGTTGATGAGGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-741s21c1
Sequence:CCGGTGTTCTGGGTAGTGGACAATTCTCGAGAATTGTCCACTACCCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-260s21c1
Sequence:CCGGTTCAGCACATTGATGCTTAAACTCGAGTTTAAGCATCAATGTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028839.3-452s21c1
Sequence:CCGGGTAGGCATGCTGCTCATTTATCTCGAGATAAATGAGCAGCATGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks