EMAIL THIS PAGE TO A FRIEND

TMEM114

transmembrane protein 114

UniProtKB ID: B3SHH9
Gene ID:
Rat(501675) transmembrane protein 114
chicken(771894) transmembrane protein 114
domestic cat(101089315) transmembrane protein 114
dog(490014) transmembrane protein 114
domestic guinea pig(100724881) transmembrane protein 114
naked mole-rat(101711638) transmembrane protein 114
cow(787012) transmembrane protein 114
sheep(101105548) transmembrane protein 114
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146336 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716059 Rosetta Predictions human pricing
XM_208930 Rosetta Predictions human pricing
NM_001134638 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407898 predicted 886
2 SASI_Hs02_00407899 predicted 243
3 SASI_Hs02_00407900 predicted 881
4 SASI_Hs02_00407901 predicted 444
5 SASI_Hs02_00407902 predicted 888
6 SASI_Hs02_00407903 predicted 453
7 SASI_Hs02_00407904 predicted 1049
8 SASI_Hs02_00407905 predicted 1170
9 SASI_Hs02_00407906 predicted 1057
10 SASI_Hs02_00407907 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478937 predicted 216
2 SASI_Hs02_00478938 predicted 498
3 SASI_Hs02_00478939 predicted 276
4 SASI_Hs01_00297223 predicted 430
5 SASI_Hs02_00478940 predicted 271
6 SASI_Hs02_00478941 predicted 233
7 SASI_Hs01_00297224 predicted 350
8 SASI_Hs02_00478942 predicted 233
9 SASI_Hs01_00297225 predicted 421
10 SASI_Hs01_00297226 predicted 319
11 SASI_Hs01_00297222 predicted 349
12 SASI_Hs01_00297227 predicted 322
13 SASI_Hs01_00297228 predicted 227
14 SASI_Hs01_00297229 predicted 203
15 SASI_Hs01_00297230 predicted 535
16 SASI_Hs01_00297231 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257859 predicted 864
2 SASI_Rn02_00257860 predicted 951
3 SASI_Rn02_00257861 predicted 1199
4 SASI_Rn02_00257862 predicted 1035
5 SASI_Rn02_00257863 predicted 815
6 SASI_Rn02_00257864 predicted 865
7 SASI_Rn02_00257865 predicted 815
8 SASI_Rn02_00257866 predicted 1187
9 SASI_Rn02_00257867 predicted 622
10 SASI_Rn02_00257868 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146336
TMEM114 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 114
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-428s21c1
Sequence:CCGGTCCTCTTTGGAGCCATGGTGACTCGAGTCACCATGGCTCCAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-335s21c1
Sequence:CCGGTCAGCCTGATCCTGATGGTTTCTCGAGAAACCATCAGGATCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-461s21c1
Sequence:CCGGTCAGCGTCTACATAGCGTATTCTCGAGAATACGCTATGTAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-264s21c1
Sequence:CCGGGAACGTGACAGTCAGCGAATCCTCGAGGATTCGCTGACTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-81s21c1
Sequence:CCGGCGGCACGGACTTCTGGTATATCTCGAGATATACCAGAAGTCCGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-744s21c1
Sequence:CCGGTGCGGCCTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-530s21c1
Sequence:CCGGTCCTGGACCAGGTGGACATCACTCGAGTGATGTCCACCTGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-720s21c1
Sequence:CCGGCTTCACCGACCGATCTCCATCCTCGAGGATGGAGATCGGTCGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146336
TMEM114 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 114
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-428s21c1
Sequence:CCGGTCCTCTTTGGAGCCATGGTGACTCGAGTCACCATGGCTCCAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-335s21c1
Sequence:CCGGTCAGCCTGATCCTGATGGTTTCTCGAGAAACCATCAGGATCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-461s21c1
Sequence:CCGGTCAGCGTCTACATAGCGTATTCTCGAGAATACGCTATGTAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-264s21c1
Sequence:CCGGGAACGTGACAGTCAGCGAATCCTCGAGGATTCGCTGACTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-81s21c1
Sequence:CCGGCGGCACGGACTTCTGGTATATCTCGAGATATACCAGAAGTCCGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-744s21c1
Sequence:CCGGTGCGGCCTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-530s21c1
Sequence:CCGGTCCTGGACCAGGTGGACATCACTCGAGTGATGTCCACCTGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-720s21c1
Sequence:CCGGCTTCACCGACCGATCTCCATCCTCGAGGATGGAGATCGGTCGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146336
TMEM114 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 114
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-428s21c1
Sequence:CCGGTCCTCTTTGGAGCCATGGTGACTCGAGTCACCATGGCTCCAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-335s21c1
Sequence:CCGGTCAGCCTGATCCTGATGGTTTCTCGAGAAACCATCAGGATCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-461s21c1
Sequence:CCGGTCAGCGTCTACATAGCGTATTCTCGAGAATACGCTATGTAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-264s21c1
Sequence:CCGGGAACGTGACAGTCAGCGAATCCTCGAGGATTCGCTGACTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-81s21c1
Sequence:CCGGCGGCACGGACTTCTGGTATATCTCGAGATATACCAGAAGTCCGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-744s21c1
Sequence:CCGGTGCGGCCTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAGGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146336.1-530s21c1
Sequence:CCGGTCCTGGACCAGGTGGACATCACTCGAGTGATGTCCACCTGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146336.1-720s21c1
Sequence:CCGGCTTCACCGACCGATCTCCATCCTCGAGGATGGAGATCGGTCGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks