EMAIL THIS PAGE TO A FRIEND

TMEM115

transmembrane protein 115

Synonyms: PL6
UniProtKB ID: Q12893, A2IDB7, O14568, Q6IAY4, Q9UIX3
Gene ID:
Mouse(56395) transmembrane protein 115
Rat(363136) transmembrane protein 115
cow(532459) transmembrane protein 115
sheep(101120199) transmembrane protein 115
naked mole-rat(101710348) transmembrane protein 115
domestic guinea pig(100733819) transmembrane protein 115
Zebrafish(619264) transmembrane protein 115
domestic cat(101095643) transmembrane protein 115
dog(484758) transmembrane protein 115
chicken(429757) transmembrane protein 115
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007024 Rosetta Predictions human pricing
NM_001108779 Rosetta Predictions rat pricing
NM_019704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242638 predicted 1624
2 SASI_Hs01_00242639 predicted 519
3 SASI_Hs01_00242640 predicted 1543
4 SASI_Hs01_00242641 predicted 1287
5 SASI_Hs01_00242642 predicted 517
6 SASI_Hs01_00242643 predicted 1733
7 SASI_Hs01_00242644 predicted 1729
8 SASI_Hs02_00342789 predicted 1811
9 SASI_Hs01_00242645 predicted 1325
10 SASI_Hs01_00242646 predicted 545
11 SASI_Hs01_00242647 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241995 predicted 1810
2 SASI_Rn02_00241996 predicted 762
3 SASI_Rn02_00241997 predicted 1885
4 SASI_Rn02_00241998 predicted 760
5 SASI_Rn02_00241999 predicted 1894
6 SASI_Rn02_00242000 predicted 1112
7 SASI_Rn02_00242001 predicted 1723
8 SASI_Rn02_00242002 predicted 1100
9 SASI_Rn02_00242003 predicted 1211
10 SASI_Rn02_00242004 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039228 predicted 773
2 SASI_Mm01_00039229 predicted 537
3 SASI_Mm01_00039231 predicted 1806
4 SASI_Mm01_00039232 predicted 1381
5 SASI_Mm01_00039233 predicted 1487
6 SASI_Mm01_00039234 predicted 1118
7 SASI_Mm01_00039235 predicted 1899
8 SASI_Mm02_00324808 predicted 1400
9 SASI_Mm02_00324809 predicted 811
10 SASI_Mm02_00324810 predicted 910
11 SASI_Mm01_00039230 predicted 1836
12 SASI_Mm01_00039236 predicted 904
13 SASI_Mm01_00039237 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007024
VALIDATED
TMEM115 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 115
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-831s21c1
Sequence:CCGGACCTGTTCACTGTCCGTATCCCTCGAGGGATACGGACAGTGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1453s21c1
Sequence:CCGGCCCAGAATCCAGTCTAATCACCTCGAGGTGATTAGACTGGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1211s21c1
Sequence:CCGCACGGTGAAGCGCTACGATGTGCTCGAGCACATCGTAGCGCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-746s21c1
Sequence:CCGGTTCTTCTCAGTGGTGAATGTGCTCGAGCACATTCACCACTGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1672s1c1
Sequence:CCGGCCAACTCCAGACAACCACTATCTCGAGATAGTGGTTGTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1730s1c1
Sequence:CCGGGCCCTCATCTGAGGTAAGAATCTCGAGATTCTTACCTCAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007024.4-1045s1c1
Sequence:CCGGCAGTTGGGTATATCTTCGCTTCTCGAGAAGCGAAGATATACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1189s1c1
Sequence:CCGGGAAGGTAAAGATATGCCAGAACTCGAGTTCTGGCATATCTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007024
VALIDATED
TMEM115 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 115
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-831s21c1
Sequence:CCGGACCTGTTCACTGTCCGTATCCCTCGAGGGATACGGACAGTGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1453s21c1
Sequence:CCGGCCCAGAATCCAGTCTAATCACCTCGAGGTGATTAGACTGGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1211s21c1
Sequence:CCGCACGGTGAAGCGCTACGATGTGCTCGAGCACATCGTAGCGCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-746s21c1
Sequence:CCGGTTCTTCTCAGTGGTGAATGTGCTCGAGCACATTCACCACTGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1672s1c1
Sequence:CCGGCCAACTCCAGACAACCACTATCTCGAGATAGTGGTTGTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1730s1c1
Sequence:CCGGGCCCTCATCTGAGGTAAGAATCTCGAGATTCTTACCTCAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007024.4-1045s1c1
Sequence:CCGGCAGTTGGGTATATCTTCGCTTCTCGAGAAGCGAAGATATACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1189s1c1
Sequence:CCGGGAAGGTAAAGATATGCCAGAACTCGAGTTCTGGCATATCTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007024
VALIDATED
TMEM115 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 115
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-831s21c1
Sequence:CCGGACCTGTTCACTGTCCGTATCCCTCGAGGGATACGGACAGTGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1453s21c1
Sequence:CCGGCCCAGAATCCAGTCTAATCACCTCGAGGTGATTAGACTGGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-1211s21c1
Sequence:CCGCACGGTGAAGCGCTACGATGTGCTCGAGCACATCGTAGCGCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007024.4-746s21c1
Sequence:CCGGTTCTTCTCAGTGGTGAATGTGCTCGAGCACATTCACCACTGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1672s1c1
Sequence:CCGGCCAACTCCAGACAACCACTATCTCGAGATAGTGGTTGTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1730s1c1
Sequence:CCGGGCCCTCATCTGAGGTAAGAATCTCGAGATTCTTACCTCAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007024.4-1045s1c1
Sequence:CCGGCAGTTGGGTATATCTTCGCTTCTCGAGAAGCGAAGATATACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007024.4-1189s1c1
Sequence:CCGGGAAGGTAAAGATATGCCAGAACTCGAGTTCTGGCATATCTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019704
TMEM115 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 115
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1269s1c1
Sequence:CCGGCCTCCTGGTGAAAGTAAAGATCTCGAGATCTTTACTTTCACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-912s1c1
Sequence:CCGGCTTGGTTTACCTGTTCACTATCTCGAGATAGTGAACAGGTAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1379s1c1
Sequence:CCGGGCAGAAGGCAACTAGCCCTAACTCGAGTTAGGGCTAGTTGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1125s1c1
Sequence:CCGGGCTGCTATCCAGTTGGGTGTACTCGAGTACACCCAACTGGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-622s1c1
Sequence:CCGGGTACTGTTTCTCTACCTGCTTCTCGAGAAGCAGGTAGAGAAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019704
TMEM115 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 115
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1269s1c1
Sequence:CCGGCCTCCTGGTGAAAGTAAAGATCTCGAGATCTTTACTTTCACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-912s1c1
Sequence:CCGGCTTGGTTTACCTGTTCACTATCTCGAGATAGTGAACAGGTAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1379s1c1
Sequence:CCGGGCAGAAGGCAACTAGCCCTAACTCGAGTTAGGGCTAGTTGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1125s1c1
Sequence:CCGGGCTGCTATCCAGTTGGGTGTACTCGAGTACACCCAACTGGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-622s1c1
Sequence:CCGGGTACTGTTTCTCTACCTGCTTCTCGAGAAGCAGGTAGAGAAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019704
TMEM115 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 115
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1269s1c1
Sequence:CCGGCCTCCTGGTGAAAGTAAAGATCTCGAGATCTTTACTTTCACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-912s1c1
Sequence:CCGGCTTGGTTTACCTGTTCACTATCTCGAGATAGTGAACAGGTAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1379s1c1
Sequence:CCGGGCAGAAGGCAACTAGCCCTAACTCGAGTTAGGGCTAGTTGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-1125s1c1
Sequence:CCGGGCTGCTATCCAGTTGGGTGTACTCGAGTACACCCAACTGGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019704.1-622s1c1
Sequence:CCGGGTACTGTTTCTCTACCTGCTTCTCGAGAAGCAGGTAGAGAAACAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks