EMAIL THIS PAGE TO A FRIEND

TMEM116

transmembrane protein 116

UniProtKB ID: Q8NCL8, G3V1W7, G5E985, Q6NSH5, Q8IZ66
Gene ID:
Mouse(77462) transmembrane protein 116
Rat(690442) transmembrane protein 116
chicken(416881) transmembrane protein 116
dog(610969) transmembrane protein 116
domestic cat(101083716) transmembrane protein 116
domestic guinea pig(100731074) transmembrane protein 116
naked mole-rat(101705864) transmembrane protein 116
cow(514512) transmembrane protein 116
sheep(101110707) transmembrane protein 116
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040720 Anti-TMEM116 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067261 MISSION® esiRNA esiRNA human TMEM116 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138341 Rosetta Predictions human pricing
XM_001074467 Rosetta Predictions rat pricing
NM_029912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041037 predicted 1486
2 SASI_Hs01_00041038 predicted 1193
3 SASI_Hs01_00041039 predicted 1044
4 SASI_Hs01_00041040 predicted 985
5 SASI_Hs01_00041041 predicted 1277
6 SASI_Hs01_00041043 predicted 1243
7 SASI_Hs01_00041044 predicted 1400
8 SASI_Hs01_00041045 predicted 952
9 SASI_Hs01_00041046 predicted 952
10 SASI_Hs02_00363430 predicted 783
11 SASI_Hs01_00041042 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346348 predicted 401
2 SASI_Rn02_00346349 predicted 320
3 SASI_Rn02_00346350 predicted 252
4 SASI_Rn02_00346351 predicted 660
5 SASI_Rn02_00346352 predicted 642
6 SASI_Rn02_00346353 predicted 226
7 SASI_Rn02_00346354 predicted 665
8 SASI_Rn02_00346355 predicted 408
9 SASI_Rn02_00346356 predicted 814
10 SASI_Rn02_00346357 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178825 predicted 940
2 SASI_Mm01_00178826 predicted 615
3 SASI_Mm01_00178827 predicted 972
4 SASI_Mm01_00178828 predicted 851
5 SASI_Mm01_00178829 predicted 842
6 SASI_Mm01_00178830 predicted 604
7 SASI_Mm01_00178831 predicted 972
8 SASI_Mm01_00178832 predicted 498
9 SASI_Mm02_00336172 predicted 467
10 SASI_Mm01_00178833 predicted 417
11 SASI_Mm01_00178834 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138341
TMEM116 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 116
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-980s1c1
Sequence:CCGGCCGAGCCCAGACATTGTATAACTCGAGTTATACAATGTCTGGGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-758s1c1
Sequence:CCGGGCTATTGATGACACCTGTATTCTCGAGAATACAGGTGTCATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-1287s1c1
Sequence:CCGGGATACCCAGACACCATTATTACTCGAGTAATAATGGTGTCTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1309s1c1
Sequence:CCGGGCTCACAGAAGAGATTCTATACTCGAGTATAGAATCTCTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-821s1c1
Sequence:CCGGGAGCCACAAGTGTATCTTGATCTCGAGATCAAGATACACTTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1109s1c1
Sequence:CCGGCCCAGCTGTCATTCTAATGATCTCGAGATCATTAGAATGACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138341.1-1435s1c1
Sequence:CCGGCGCTAATGGATTGGAAAGAATCTCGAGATTCTTTCCAATCCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138341
TMEM116 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 116
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-980s1c1
Sequence:CCGGCCGAGCCCAGACATTGTATAACTCGAGTTATACAATGTCTGGGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-758s1c1
Sequence:CCGGGCTATTGATGACACCTGTATTCTCGAGAATACAGGTGTCATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-1287s1c1
Sequence:CCGGGATACCCAGACACCATTATTACTCGAGTAATAATGGTGTCTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1309s1c1
Sequence:CCGGGCTCACAGAAGAGATTCTATACTCGAGTATAGAATCTCTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-821s1c1
Sequence:CCGGGAGCCACAAGTGTATCTTGATCTCGAGATCAAGATACACTTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1109s1c1
Sequence:CCGGCCCAGCTGTCATTCTAATGATCTCGAGATCATTAGAATGACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138341.1-1435s1c1
Sequence:CCGGCGCTAATGGATTGGAAAGAATCTCGAGATTCTTTCCAATCCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138341
TMEM116 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 116
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-980s1c1
Sequence:CCGGCCGAGCCCAGACATTGTATAACTCGAGTTATACAATGTCTGGGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-758s1c1
Sequence:CCGGGCTATTGATGACACCTGTATTCTCGAGAATACAGGTGTCATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-1287s1c1
Sequence:CCGGGATACCCAGACACCATTATTACTCGAGTAATAATGGTGTCTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1309s1c1
Sequence:CCGGGCTCACAGAAGAGATTCTATACTCGAGTATAGAATCTCTTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138341.1-821s1c1
Sequence:CCGGGAGCCACAAGTGTATCTTGATCTCGAGATCAAGATACACTTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138341.1-1109s1c1
Sequence:CCGGCCCAGCTGTCATTCTAATGATCTCGAGATCATTAGAATGACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138341.1-1435s1c1
Sequence:CCGGCGCTAATGGATTGGAAAGAATCTCGAGATTCTTTCCAATCCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029912
TMEM116 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 116
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-875s1c1
Sequence:CCGGCAGTGCAAGTTCCAGCAGATACTCGAGTATCTGCTGGAACTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029912.1-1051s1c1
Sequence:CCGGGAGTGAATGTTTCACATGAGTCTCGAGACTCATGTGAAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-510s1c1
Sequence:CCGGCTTCCACCAATACATCTGTCTCTCGAGAGACAGATGTATTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-954s1c1
Sequence:CCGGGAATTTATAGTAGAAGCCCAACTCGAGTTGGGCTTCTACTATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029912
TMEM116 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 116
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-875s1c1
Sequence:CCGGCAGTGCAAGTTCCAGCAGATACTCGAGTATCTGCTGGAACTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029912.1-1051s1c1
Sequence:CCGGGAGTGAATGTTTCACATGAGTCTCGAGACTCATGTGAAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-510s1c1
Sequence:CCGGCTTCCACCAATACATCTGTCTCTCGAGAGACAGATGTATTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-954s1c1
Sequence:CCGGGAATTTATAGTAGAAGCCCAACTCGAGTTGGGCTTCTACTATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029912
TMEM116 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 116
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-875s1c1
Sequence:CCGGCAGTGCAAGTTCCAGCAGATACTCGAGTATCTGCTGGAACTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029912.1-1051s1c1
Sequence:CCGGGAGTGAATGTTTCACATGAGTCTCGAGACTCATGTGAAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-510s1c1
Sequence:CCGGCTTCCACCAATACATCTGTCTCTCGAGAGACAGATGTATTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029912.1-954s1c1
Sequence:CCGGGAATTTATAGTAGAAGCCCAACTCGAGTTGGGCTTCTACTATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks