EMAIL THIS PAGE TO A FRIEND

TMEM117

transmembrane protein 117

UniProtKB ID: Q9H0C3
Gene ID:
Mouse(320709) transmembrane protein 117
Rat(500921) transmembrane protein 117
cow(614719) transmembrane protein 117
sheep(101114508) transmembrane protein 117
naked mole-rat(101696836) transmembrane protein 117
Domestic Rabbit(100356294) transmembrane protein 117
domestic guinea pig(100714512) transmembrane protein 117
Zebrafish(406763) transmembrane protein 117
dog(609688) transmembrane protein 117
Horse(100050185) transmembrane protein 117
domestic cat(101100485) transmembrane protein 117
chicken(417798) transmembrane protein 117
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032256 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155081 MISSION® esiRNA esiRNA human TMEM117 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032256 Rosetta Predictions human pricing
XM_001058576 Rosetta Predictions rat pricing
XM_576330 Rosetta Predictions rat pricing
NM_178789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359561 predicted 658
2 SASI_Hs01_00225026 predicted 1222
3 SASI_Hs01_00225027 predicted 1136
4 SASI_Hs01_00225028 predicted 306
5 SASI_Hs01_00225029 predicted 1155
6 SASI_Hs01_00225030 predicted 1208
7 SASI_Hs01_00225031 predicted 297
8 SASI_Hs01_00225032 predicted 559
9 SASI_Hs02_00359562 predicted 577
10 SASI_Hs02_00359563 predicted 802
11 SASI_Hs01_00225025 predicted 586
12 SASI_Hs01_00225033 predicted 471
13 SASI_Hs01_00225034 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290207 predicted 650
2 SASI_Rn02_00290208 predicted 601
3 SASI_Rn02_00290209 predicted 1124
4 SASI_Rn02_00290210 predicted 578
5 SASI_Rn02_00290211 predicted 1725
6 SASI_Rn02_00290212 predicted 386
7 SASI_Rn02_00290213 predicted 1044
8 SASI_Rn02_00290214 predicted 1767
9 SASI_Rn02_00290215 predicted 1557
10 SASI_Rn02_00290216 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405089 predicted 134
2 SASI_Rn02_00405090 predicted 82
3 SASI_Rn02_00405091 predicted 604
4 SASI_Rn02_00405092 predicted 63
5 SASI_Rn02_00405093 predicted 1201
6 SASI_Rn02_00405094 predicted 526
7 SASI_Rn02_00405095 predicted 133
8 SASI_Rn02_00405096 predicted 1248
9 SASI_Rn02_00405097 predicted 788
10 SASI_Rn02_00405098 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109646 predicted 1048
2 SASI_Mm01_00109648 predicted 1121
3 SASI_Mm01_00109650 predicted 1690
4 SASI_Mm01_00109651 predicted 1233
5 SASI_Mm01_00109652 predicted 1538
6 SASI_Mm02_00349385 predicted 1665
7 SASI_Mm01_00109653 predicted 1054
8 SASI_Mm01_00109654 predicted 1030
9 SASI_Mm02_00349386 predicted 1560
10 SASI_Mm02_00349387 predicted 1522
11 SASI_Mm01_00109647 predicted 200
12 SASI_Mm01_00109649 predicted 554
13 SASI_Mm01_00109655 predicted 1772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178789
TMEM117 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 117
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-2055s1c1
Sequence:CCGGCCAGTCTATTTCACATGGGATCTCGAGATCCCATGTGAAATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-557s1c1
Sequence:CCGGGCTTATCTCATCACTGACTATCTCGAGATAGTCAGTGATGAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1611s1c1
Sequence:CCGGGCTTACATCTGAAGGAATCTACTCGAGTAGATTCCTTCAGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1478s1c1
Sequence:CCGGGATATGGGAATCACCCGAGAACTCGAGTTCTCGGGTGATTCCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-200s1c1
Sequence:CCGGGCTTACCTGGTCATCTTCTTTCTCGAGAAAGAAGATGACCAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-1060s1c1
Sequence:CCGGCGGAATTATCTTTCTCGTCTTCTCGAGAAGACGAGAAAGATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-2461s1c1
Sequence:CCGGGCTCTCAAATGTATTGGCATTCTCGAGAATGCCAATACATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-587s1c1
Sequence:CCGGCGCAATGAAAGTTTCATGAAACTCGAGTTTCATGAAACTTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-1780s1c1
Sequence:CCGGGCGTTAGGTAAAGAAATACAACTCGAGTTGTATTTCTTTACCTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-586s1c1
Sequence:CCGGCCGCAATGAAAGTTTCATGAACTCGAGTTCATGAAACTTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-1946s1c1
Sequence:CCGGGCAAGGTAGATTAGCCGATTACTCGAGTAATCGGCTAATCTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178789
TMEM117 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 117
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-2055s1c1
Sequence:CCGGCCAGTCTATTTCACATGGGATCTCGAGATCCCATGTGAAATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-557s1c1
Sequence:CCGGGCTTATCTCATCACTGACTATCTCGAGATAGTCAGTGATGAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1611s1c1
Sequence:CCGGGCTTACATCTGAAGGAATCTACTCGAGTAGATTCCTTCAGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1478s1c1
Sequence:CCGGGATATGGGAATCACCCGAGAACTCGAGTTCTCGGGTGATTCCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-200s1c1
Sequence:CCGGGCTTACCTGGTCATCTTCTTTCTCGAGAAAGAAGATGACCAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-1060s1c1
Sequence:CCGGCGGAATTATCTTTCTCGTCTTCTCGAGAAGACGAGAAAGATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-2461s1c1
Sequence:CCGGGCTCTCAAATGTATTGGCATTCTCGAGAATGCCAATACATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-587s1c1
Sequence:CCGGCGCAATGAAAGTTTCATGAAACTCGAGTTTCATGAAACTTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-1780s1c1
Sequence:CCGGGCGTTAGGTAAAGAAATACAACTCGAGTTGTATTTCTTTACCTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-586s1c1
Sequence:CCGGCCGCAATGAAAGTTTCATGAACTCGAGTTCATGAAACTTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-1946s1c1
Sequence:CCGGGCAAGGTAGATTAGCCGATTACTCGAGTAATCGGCTAATCTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178789
TMEM117 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 117
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-2055s1c1
Sequence:CCGGCCAGTCTATTTCACATGGGATCTCGAGATCCCATGTGAAATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-557s1c1
Sequence:CCGGGCTTATCTCATCACTGACTATCTCGAGATAGTCAGTGATGAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1611s1c1
Sequence:CCGGGCTTACATCTGAAGGAATCTACTCGAGTAGATTCCTTCAGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-1478s1c1
Sequence:CCGGGATATGGGAATCACCCGAGAACTCGAGTTCTCGGGTGATTCCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178789.2-200s1c1
Sequence:CCGGGCTTACCTGGTCATCTTCTTTCTCGAGAAAGAAGATGACCAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-1060s1c1
Sequence:CCGGCGGAATTATCTTTCTCGTCTTCTCGAGAAGACGAGAAAGATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-2461s1c1
Sequence:CCGGGCTCTCAAATGTATTGGCATTCTCGAGAATGCCAATACATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-587s1c1
Sequence:CCGGCGCAATGAAAGTTTCATGAAACTCGAGTTTCATGAAACTTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178789.2-1780s1c1
Sequence:CCGGGCGTTAGGTAAAGAAATACAACTCGAGTTGTATTTCTTTACCTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178789.2-586s1c1
Sequence:CCGGCCGCAATGAAAGTTTCATGAACTCGAGTTCATGAAACTTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178789.2-1946s1c1
Sequence:CCGGGCAAGGTAGATTAGCCGATTACTCGAGTAATCGGCTAATCTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032256
VALIDATED
TMEM117 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 117
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-779s1c1
Sequence:CCGGCCAGAGCATTCCTTGCTTCTTCTCGAGAAGAAGCAAGGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-299s1c1
Sequence:CCGGCAGGACTAATAGCTGGCAAATCTCGAGATTTGCCAGCTATTAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-1532s1c1
Sequence:CCGGGCTCACAGTTGAACGAATCTACTCGAGTAGATTCGTTCAACTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1615s1c1
Sequence:CCGGCGGAGATAGACTTGGAGATAACTCGAGTTATCTCCAAGTCTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1841s1c1
Sequence:CCGGGCACAAGCTATTACTGACTTTCTCGAGAAAGTCAGTAATAGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032256.1-121s1c1
Sequence:CCGGGCTTACTTGGTGATCTTCTTTCTCGAGAAAGAAGATCACCAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-895s1c1
Sequence:CCGGCCTCACATGCAGTTCAAGATTCTCGAGAATCTTGAACTGCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-179s1c1
Sequence:CCGGGCCAAACAGAAGCCAATGTTACTCGAGTAACATTGGCTTCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-98s21c1
Sequence:CCGGATCCCTGGTCTCGCATGATTGCTCGAGCAATCATGCGAGACCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1018s21c1
Sequence:CCGGATGTGGAAGAACCAAATATTTCTCGAGAAATATTTGGTTCTTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1644s21c1
Sequence:CCGGGCAACCTTGAGTGTAACTTTACTCGAGTAAAGTTACACTCAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1913s21c1
Sequence:CCGGAGTGGTGCCTTGAGACATTAACTCGAGTTAATGTCTCAAGGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-805s21c1
Sequence:CCGGTTGGTCTTTGACCTTCTTATTCTCGAGAATAAGAAGGTCAAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1966s21c1
Sequence:CCGGGAACAGTTACCTAACCTATTTCTCGAGAAATAGGTTAGGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1161s21c1
Sequence:CCGGCACTAACCCTCGGACTAATAACTCGAGTTATTAGTCCGAGGGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1297s21c1
Sequence:CCGGATTTGGTTCTTTGGACGATTTCTCGAGAAATCGTCCAAAGAACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-493s21c1
Sequence:CCGGGACTATATGGGCATCCGAAATCTCGAGATTTCGGATGCCCATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-957s21c1
Sequence:CCGGCATAACAGGCAAATGGTTTAACTCGAGTTAAACCATTTGCCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-394s21c1
Sequence:CCGGACAATGTTCTTCAGCACAATTCTCGAGAATTGTGCTGAAGAACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-340s21c1
Sequence:CCGGTTTGGTCAGTTGCTCCGATTACTCGAGTAATCGGAGCAACTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032256
VALIDATED
TMEM117 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 117
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-779s1c1
Sequence:CCGGCCAGAGCATTCCTTGCTTCTTCTCGAGAAGAAGCAAGGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-299s1c1
Sequence:CCGGCAGGACTAATAGCTGGCAAATCTCGAGATTTGCCAGCTATTAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-1532s1c1
Sequence:CCGGGCTCACAGTTGAACGAATCTACTCGAGTAGATTCGTTCAACTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1615s1c1
Sequence:CCGGCGGAGATAGACTTGGAGATAACTCGAGTTATCTCCAAGTCTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1841s1c1
Sequence:CCGGGCACAAGCTATTACTGACTTTCTCGAGAAAGTCAGTAATAGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032256.1-121s1c1
Sequence:CCGGGCTTACTTGGTGATCTTCTTTCTCGAGAAAGAAGATCACCAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-895s1c1
Sequence:CCGGCCTCACATGCAGTTCAAGATTCTCGAGAATCTTGAACTGCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-179s1c1
Sequence:CCGGGCCAAACAGAAGCCAATGTTACTCGAGTAACATTGGCTTCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-98s21c1
Sequence:CCGGATCCCTGGTCTCGCATGATTGCTCGAGCAATCATGCGAGACCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1018s21c1
Sequence:CCGGATGTGGAAGAACCAAATATTTCTCGAGAAATATTTGGTTCTTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1644s21c1
Sequence:CCGGGCAACCTTGAGTGTAACTTTACTCGAGTAAAGTTACACTCAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1913s21c1
Sequence:CCGGAGTGGTGCCTTGAGACATTAACTCGAGTTAATGTCTCAAGGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-805s21c1
Sequence:CCGGTTGGTCTTTGACCTTCTTATTCTCGAGAATAAGAAGGTCAAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1966s21c1
Sequence:CCGGGAACAGTTACCTAACCTATTTCTCGAGAAATAGGTTAGGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1161s21c1
Sequence:CCGGCACTAACCCTCGGACTAATAACTCGAGTTATTAGTCCGAGGGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1297s21c1
Sequence:CCGGATTTGGTTCTTTGGACGATTTCTCGAGAAATCGTCCAAAGAACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-493s21c1
Sequence:CCGGGACTATATGGGCATCCGAAATCTCGAGATTTCGGATGCCCATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-957s21c1
Sequence:CCGGCATAACAGGCAAATGGTTTAACTCGAGTTAAACCATTTGCCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-394s21c1
Sequence:CCGGACAATGTTCTTCAGCACAATTCTCGAGAATTGTGCTGAAGAACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-340s21c1
Sequence:CCGGTTTGGTCAGTTGCTCCGATTACTCGAGTAATCGGAGCAACTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032256
VALIDATED
TMEM117 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 117
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-779s1c1
Sequence:CCGGCCAGAGCATTCCTTGCTTCTTCTCGAGAAGAAGCAAGGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-299s1c1
Sequence:CCGGCAGGACTAATAGCTGGCAAATCTCGAGATTTGCCAGCTATTAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-1532s1c1
Sequence:CCGGGCTCACAGTTGAACGAATCTACTCGAGTAGATTCGTTCAACTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1615s1c1
Sequence:CCGGCGGAGATAGACTTGGAGATAACTCGAGTTATCTCCAAGTCTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032256.1-1841s1c1
Sequence:CCGGGCACAAGCTATTACTGACTTTCTCGAGAAAGTCAGTAATAGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032256.1-121s1c1
Sequence:CCGGGCTTACTTGGTGATCTTCTTTCTCGAGAAAGAAGATCACCAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032256.1-895s1c1
Sequence:CCGGCCTCACATGCAGTTCAAGATTCTCGAGAATCTTGAACTGCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032256.1-179s1c1
Sequence:CCGGGCCAAACAGAAGCCAATGTTACTCGAGTAACATTGGCTTCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-98s21c1
Sequence:CCGGATCCCTGGTCTCGCATGATTGCTCGAGCAATCATGCGAGACCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1018s21c1
Sequence:CCGGATGTGGAAGAACCAAATATTTCTCGAGAAATATTTGGTTCTTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1644s21c1
Sequence:CCGGGCAACCTTGAGTGTAACTTTACTCGAGTAAAGTTACACTCAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1913s21c1
Sequence:CCGGAGTGGTGCCTTGAGACATTAACTCGAGTTAATGTCTCAAGGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-805s21c1
Sequence:CCGGTTGGTCTTTGACCTTCTTATTCTCGAGAATAAGAAGGTCAAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032256.1-1966s21c1
Sequence:CCGGGAACAGTTACCTAACCTATTTCTCGAGAAATAGGTTAGGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1161s21c1
Sequence:CCGGCACTAACCCTCGGACTAATAACTCGAGTTATTAGTCCGAGGGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-1297s21c1
Sequence:CCGGATTTGGTTCTTTGGACGATTTCTCGAGAAATCGTCCAAAGAACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-493s21c1
Sequence:CCGGGACTATATGGGCATCCGAAATCTCGAGATTTCGGATGCCCATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-957s21c1
Sequence:CCGGCATAACAGGCAAATGGTTTAACTCGAGTTAAACCATTTGCCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-394s21c1
Sequence:CCGGACAATGTTCTTCAGCACAATTCTCGAGAATTGTGCTGAAGAACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032256.1-340s21c1
Sequence:CCGGTTTGGTCAGTTGCTCCGATTACTCGAGTAATCGGAGCAACTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks