EMAIL THIS PAGE TO A FRIEND

TMEM119

transmembrane protein 119

UniProtKB ID: Q4V9L6, Q6UXE5, Q8N2F5
Gene ID:
Mouse(231633) transmembrane protein 119
Rat(304581) transmembrane protein 119
chicken(416892) transmembrane protein 119
domestic cat(101094792) transmembrane protein 119
dog(611689) transmembrane protein 119
domestic guinea pig(100723404) transmembrane protein 119
naked mole-rat(101713557) transmembrane protein 119
cow(510926) transmembrane protein 119
sheep(101102841) transmembrane protein 119
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181724 Rosetta Predictions human pricing
NM_001107155 Rosetta Predictions rat pricing
NM_146162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197798 predicted 800
2 SASI_Hs01_00197799 predicted 977
3 SASI_Hs01_00197800 predicted 800
4 SASI_Hs01_00197801 predicted 809
5 SASI_Hs02_00370333 predicted 909
6 SASI_Hs02_00370334 predicted 977
7 SASI_Hs02_00370335 predicted 815
8 SASI_Hs01_00197803 predicted 1091
9 SASI_Hs01_00197805 predicted 1368
10 SASI_Hs01_00197806 predicted 289
11 SASI_Hs01_00197802 predicted 983
12 SASI_Hs01_00197804 predicted 1366
13 SASI_Hs01_00197807 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226045 predicted 1301
2 SASI_Rn02_00226046 predicted 1461
3 SASI_Rn02_00226047 predicted 1084
4 SASI_Rn02_00226048 predicted 1237
5 SASI_Rn02_00226049 predicted 377
6 SASI_Rn02_00226050 predicted 1025
7 SASI_Rn02_00226051 predicted 485
8 SASI_Rn02_00226052 predicted 1165
9 SASI_Rn02_00226053 predicted 1395
10 SASI_Rn02_00226054 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341858 predicted 501
2 SASI_Mm01_00030469 predicted 985
3 SASI_Mm01_00030470 predicted 330
4 SASI_Mm01_00030471 predicted 857
5 SASI_Mm01_00030472 predicted 820
6 SASI_Mm01_00030473 predicted 981
7 SASI_Mm01_00030474 predicted 295
8 SASI_Mm01_00030475 predicted 1092
9 SASI_Mm01_00030476 predicted 617
10 SASI_Mm01_00030477 predicted 376
11 SASI_Mm01_00030478 predicted 1407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146162
VALIDATED
TMEM119 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 119
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-442s21c1
Sequence:CCGGACCCATCCTCGTTCCCTGAAACTCGAGTTTCAGGGAACGAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-373s21c1
Sequence:CCGGCCTTCCTCATCATGTTCATAGCTCGAGCTATGAACATGATGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-1096s21c1
Sequence:CCGGCCAAGTTCCAGCGCCCTTAATCTCGAGATTAAGGGCGCTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-860s21c1
Sequence:CCGGAGCAACTGGTCCTCCTGAAAGCTCGAGCTTTCAGGAGGACCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-309s21c1
Sequence:CCGGCTGGAAGGGATCATGGATTTCCTCGAGGAAATCCATGATCCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-827s1c1
Sequence:CCGGGCAGAAGGGTCTTTCTCCTTACTCGAGTAAGGAGAAAGACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-325s1c1
Sequence:CCGGCATGGATTTCTTCCGGCAGTACTCGAGTACTGCCGGAAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146162
VALIDATED
TMEM119 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 119
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-442s21c1
Sequence:CCGGACCCATCCTCGTTCCCTGAAACTCGAGTTTCAGGGAACGAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-373s21c1
Sequence:CCGGCCTTCCTCATCATGTTCATAGCTCGAGCTATGAACATGATGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-1096s21c1
Sequence:CCGGCCAAGTTCCAGCGCCCTTAATCTCGAGATTAAGGGCGCTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-860s21c1
Sequence:CCGGAGCAACTGGTCCTCCTGAAAGCTCGAGCTTTCAGGAGGACCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-309s21c1
Sequence:CCGGCTGGAAGGGATCATGGATTTCCTCGAGGAAATCCATGATCCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-827s1c1
Sequence:CCGGGCAGAAGGGTCTTTCTCCTTACTCGAGTAAGGAGAAAGACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-325s1c1
Sequence:CCGGCATGGATTTCTTCCGGCAGTACTCGAGTACTGCCGGAAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146162
VALIDATED
TMEM119 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 119
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-442s21c1
Sequence:CCGGACCCATCCTCGTTCCCTGAAACTCGAGTTTCAGGGAACGAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-373s21c1
Sequence:CCGGCCTTCCTCATCATGTTCATAGCTCGAGCTATGAACATGATGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-1096s21c1
Sequence:CCGGCCAAGTTCCAGCGCCCTTAATCTCGAGATTAAGGGCGCTGGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-860s21c1
Sequence:CCGGAGCAACTGGTCCTCCTGAAAGCTCGAGCTTTCAGGAGGACCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146162.2-309s21c1
Sequence:CCGGCTGGAAGGGATCATGGATTTCCTCGAGGAAATCCATGATCCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-827s1c1
Sequence:CCGGGCAGAAGGGTCTTTCTCCTTACTCGAGTAAGGAGAAAGACCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146162.1-325s1c1
Sequence:CCGGCATGGATTTCTTCCGGCAGTACTCGAGTACTGCCGGAAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181724
TMEM119 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 119
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-296s1c1
Sequence:CCGGCAACTTCCTGGATGGGATAGTCTCGAGACTATCCCATCCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-368s1c1
Sequence:CCGGCTTTCTGCTGATGTTCATCGTCTCGAGACGATGAACATCAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-330s1c1
Sequence:CCGGCAGTACGTGATGCTGATTGCTCTCGAGAGCAATCAGCATCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-2224s1c1
Sequence:CCGGGCTGGGATCAGGTTGAATGAACTCGAGTTCATTCAACCTGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1345s1c1
Sequence:CCGGGTCCACTAAATCAGCCACATTCTCGAGAATGTGGCTGATTTAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1359s1c1
Sequence:CCGGCCACATTAATTGGGAATCATACTCGAGTATGATTCCCAATTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1552s1c1
Sequence:CCGGGTGTCCTTTCAATGCTGAATACTCGAGTATTCAGCATTGAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1347s1c1
Sequence:CCGGCCACTAAATCAGCCACATTAACTCGAGTTAATGTGGCTGATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1544s1c1
Sequence:CCGGCCCTTCTTGTGTCCTTTCAATCTCGAGATTGAAAGGACACAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181724
TMEM119 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 119
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-296s1c1
Sequence:CCGGCAACTTCCTGGATGGGATAGTCTCGAGACTATCCCATCCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-368s1c1
Sequence:CCGGCTTTCTGCTGATGTTCATCGTCTCGAGACGATGAACATCAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-330s1c1
Sequence:CCGGCAGTACGTGATGCTGATTGCTCTCGAGAGCAATCAGCATCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-2224s1c1
Sequence:CCGGGCTGGGATCAGGTTGAATGAACTCGAGTTCATTCAACCTGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1345s1c1
Sequence:CCGGGTCCACTAAATCAGCCACATTCTCGAGAATGTGGCTGATTTAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1359s1c1
Sequence:CCGGCCACATTAATTGGGAATCATACTCGAGTATGATTCCCAATTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1552s1c1
Sequence:CCGGGTGTCCTTTCAATGCTGAATACTCGAGTATTCAGCATTGAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1347s1c1
Sequence:CCGGCCACTAAATCAGCCACATTAACTCGAGTTAATGTGGCTGATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1544s1c1
Sequence:CCGGCCCTTCTTGTGTCCTTTCAATCTCGAGATTGAAAGGACACAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181724
TMEM119 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 119
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-296s1c1
Sequence:CCGGCAACTTCCTGGATGGGATAGTCTCGAGACTATCCCATCCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-368s1c1
Sequence:CCGGCTTTCTGCTGATGTTCATCGTCTCGAGACGATGAACATCAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181724.1-330s1c1
Sequence:CCGGCAGTACGTGATGCTGATTGCTCTCGAGAGCAATCAGCATCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165925    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-2224s1c1
Sequence:CCGGGCTGGGATCAGGTTGAATGAACTCGAGTTCATTCAACCTGATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1345s1c1
Sequence:CCGGGTCCACTAAATCAGCCACATTCTCGAGAATGTGGCTGATTTAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1359s1c1
Sequence:CCGGCCACATTAATTGGGAATCATACTCGAGTATGATTCCCAATTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1552s1c1
Sequence:CCGGGTGTCCTTTCAATGCTGAATACTCGAGTATTCAGCATTGAAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1347s1c1
Sequence:CCGGCCACTAAATCAGCCACATTAACTCGAGTTAATGTGGCTGATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181724.1-1544s1c1
Sequence:CCGGCCCTTCTTGTGTCCTTTCAATCTCGAGATTGAAAGGACACAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks