EMAIL THIS PAGE TO A FRIEND

TMEM11

transmembrane protein 11

Synonyms: C17orf35 PM1 PMI
UniProtKB ID: P17152, Q53YB2
Gene ID:
Mouse(216821) transmembrane protein 11
Rat(303196) transmembrane protein 11
Zebrafish(407695) transmembrane protein 11
dog(479532) transmembrane protein 11
domestic cat(101082022) transmembrane protein 11
chicken(427663) transmembrane protein 11
domestic guinea pig(100728505) transmembrane protein 11
naked mole-rat(101716603) transmembrane protein 11
cow(508598) transmembrane protein 11
sheep(101122706) transmembrane protein 11
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003876 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036631 MISSION® esiRNA esiRNA human TMEM11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003876 Rosetta Predictions human pricing
NM_001113778 Rosetta Predictions rat pricing
NM_173453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187007 predicted 627
2 SASI_Hs01_00187008 predicted 420
3 SASI_Hs01_00187009 predicted 813
4 SASI_Hs01_00187010 predicted 823
5 SASI_Hs01_00187011 predicted 546
6 SASI_Hs01_00187012 predicted 656
7 SASI_Hs01_00187013 predicted 754
8 SASI_Hs01_00187014 predicted 336
9 SASI_Hs01_00187015 predicted 793
10 SASI_Hs02_00336469 predicted 372
11 SASI_Hs01_00187016 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252043 predicted 363
2 SASI_Rn02_00252044 predicted 356
3 SASI_Rn02_00252045 predicted 415
4 SASI_Rn02_00252046 predicted 510
5 SASI_Rn02_00252047 predicted 559
6 SASI_Rn02_00252048 predicted 521
7 SASI_Rn02_00252049 predicted 378
8 SASI_Rn02_00252050 predicted 393
9 SASI_Rn02_00252051 predicted 512
10 SASI_Rn02_00252052 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345360 predicted 435
2 SASI_Mm01_00181427 predicted 470
3 SASI_Mm01_00181428 predicted 630
4 SASI_Mm01_00181429 predicted 658
5 SASI_Mm01_00181430 predicted 933
6 SASI_Mm01_00181431 predicted 414
7 SASI_Mm01_00181432 predicted 602
8 SASI_Mm02_00345361 predicted 644
9 SASI_Mm01_00181433 predicted 334
10 SASI_Mm02_00345362 predicted 867
11 SASI_Mm01_00181434 predicted 424
12 SASI_Mm01_00181435 predicted 663
13 SASI_Mm01_00181436 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173453
VALIDATED
TMEM11 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173453.2-931s21c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-665s21c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-419s21c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-478s21c1
Sequence:CCGGCTGGATCACCGTAGGCAATTGCTCGAGCAATTGCCTACGGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-441s21c1
Sequence:CCGGTGATAGAGCCCACCCGAATTGCTCGAGCAATTCGGGTGGGCTCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-932s1c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-664s1c1
Sequence:CCGGAGGTGGAGTATGATGCCTATACTCGAGTATAGGCATCATACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-666s1c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-420s1c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173453.1-343s1c1
Sequence:CCGGACTGCTACATTGTGCACGAAACTCGAGTTTCGTGCACAATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173453
VALIDATED
TMEM11 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173453.2-931s21c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-665s21c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-419s21c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-478s21c1
Sequence:CCGGCTGGATCACCGTAGGCAATTGCTCGAGCAATTGCCTACGGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-441s21c1
Sequence:CCGGTGATAGAGCCCACCCGAATTGCTCGAGCAATTCGGGTGGGCTCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-932s1c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-664s1c1
Sequence:CCGGAGGTGGAGTATGATGCCTATACTCGAGTATAGGCATCATACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-666s1c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-420s1c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173453.1-343s1c1
Sequence:CCGGACTGCTACATTGTGCACGAAACTCGAGTTTCGTGCACAATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173453
VALIDATED
TMEM11 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173453.2-931s21c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-665s21c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-419s21c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-478s21c1
Sequence:CCGGCTGGATCACCGTAGGCAATTGCTCGAGCAATTGCCTACGGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173453.2-441s21c1
Sequence:CCGGTGATAGAGCCCACCCGAATTGCTCGAGCAATTCGGGTGGGCTCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-932s1c1
Sequence:CCGGCCTGGGAAAGTGTTTGGTTTACTCGAGTAAACCAAACACTTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-664s1c1
Sequence:CCGGAGGTGGAGTATGATGCCTATACTCGAGTATAGGCATCATACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-666s1c1
Sequence:CCGGGTGGAGTATGATGCCTATAAACTCGAGTTTATAGGCATCATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173453.1-420s1c1
Sequence:CCGGGAAGCCCAGTACAAGTACATTCTCGAGAATGTACTTGTACTGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173453.1-343s1c1
Sequence:CCGGACTGCTACATTGTGCACGAAACTCGAGTTTCGTGCACAATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003876
VALIDATED
TMEM11 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-625s21c1
Sequence:CCGGTGATTGAGCCCACTCGCATTGCTCGAGCAATGCGAGTGGGCTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003876.2-1117s21c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-938s21c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-1005s21c1
Sequence:CCGGGAACTCTATGCCGTATGATTTCTCGAGAAATCATACGGCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-849s21c1
Sequence:CCGGGTGGAGTACGACGCCTATAAACTCGAGTTTATAGGCGTCGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-932s1c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-342s1c1
Sequence:CCGGCTGCTACATTGTGCATGAGATCTCGAGATCTCATGCACAATGTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003876.1-796s1c1
Sequence:CCGGGTGTACTGTGTAAAGAAGATTCTCGAGAATCTTCTTTACACAGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-555s1c1
Sequence:CCGGGCCCTTAGATTATTCCCACTACTCGAGTAGTGGGAATAATCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-753s1c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003876
VALIDATED
TMEM11 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-625s21c1
Sequence:CCGGTGATTGAGCCCACTCGCATTGCTCGAGCAATGCGAGTGGGCTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003876.2-1117s21c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-938s21c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-1005s21c1
Sequence:CCGGGAACTCTATGCCGTATGATTTCTCGAGAAATCATACGGCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-849s21c1
Sequence:CCGGGTGGAGTACGACGCCTATAAACTCGAGTTTATAGGCGTCGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-932s1c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-342s1c1
Sequence:CCGGCTGCTACATTGTGCATGAGATCTCGAGATCTCATGCACAATGTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003876.1-796s1c1
Sequence:CCGGGTGTACTGTGTAAAGAAGATTCTCGAGAATCTTCTTTACACAGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-555s1c1
Sequence:CCGGGCCCTTAGATTATTCCCACTACTCGAGTAGTGGGAATAATCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-753s1c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003876
VALIDATED
TMEM11 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-625s21c1
Sequence:CCGGTGATTGAGCCCACTCGCATTGCTCGAGCAATGCGAGTGGGCTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003876.2-1117s21c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-938s21c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-1005s21c1
Sequence:CCGGGAACTCTATGCCGTATGATTTCTCGAGAAATCATACGGCATAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003876.2-849s21c1
Sequence:CCGGGTGGAGTACGACGCCTATAAACTCGAGTTTATAGGCGTCGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-932s1c1
Sequence:CCGGGCAGGTGTTTGGCTTAGTATTCTCGAGAATACTAAGCCAAACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-342s1c1
Sequence:CCGGCTGCTACATTGTGCATGAGATCTCGAGATCTCATGCACAATGTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003876.1-796s1c1
Sequence:CCGGGTGTACTGTGTAAAGAAGATTCTCGAGAATCTTCTTTACACAGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-555s1c1
Sequence:CCGGGCCCTTAGATTATTCCCACTACTCGAGTAGTGGGAATAATCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003876.1-753s1c1
Sequence:CCGGGCACAGAAAGAGACTGCACAACTCGAGTTGTGCAGTCTCTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks