EMAIL THIS PAGE TO A FRIEND

TMEM120A

transmembrane protein 120A

Synonyms: NET29 TMPIT
UniProtKB ID: Q9BXJ8, Q86TE9, Q8N6P1
Gene ID:
Mouse(215210) transmembrane protein 120A
Rat(288591) transmembrane protein 120A
Zebrafish(100005623) transmembrane protein 120A
domestic cat(101085338) transmembrane protein 120A
dog(479721) transmembrane protein 120A
chicken(417519) transmembrane protein 120A
cow(520173) transmembrane protein 120A
sheep(101118071) transmembrane protein 120A
naked mole-rat(101713408) transmembrane protein 120A
domestic guinea pig(100722539) transmembrane protein 120A
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031925 Rosetta Predictions human pricing
NM_001010945 Rosetta Predictions rat pricing
NM_172541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097879 predicted 707
2 SASI_Hs01_00097881 predicted 595
3 SASI_Hs01_00097882 predicted 692
4 SASI_Hs01_00097884 predicted 710
5 SASI_Hs01_00097886 predicted 358
6 SASI_Hs02_00359064 predicted 760
7 SASI_Hs02_00359065 predicted 352
8 SASI_Hs01_00097880 predicted 425
9 SASI_Hs02_00359066 predicted 176
10 SASI_Hs02_00359067 predicted 1189
11 SASI_Hs01_00097878 predicted 723
12 SASI_Hs01_00097883 predicted 522
13 SASI_Hs01_00097885 predicted 447
14 SASI_Hs01_00097887 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074406 predicted 400
2 SASI_Rn01_00074407 predicted 403
3 SASI_Rn01_00074408 predicted 607
4 SASI_Rn01_00074410 predicted 1160
5 SASI_Rn01_00074411 predicted 457
6 SASI_Rn01_00074412 predicted 1081
7 SASI_Rn01_00074413 predicted 418
8 SASI_Rn01_00074414 predicted 807
9 SASI_Rn01_00074415 predicted 440
10 SASI_Rn02_00199821 predicted 675
11 SASI_Rn01_00074409 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155173 predicted 331
2 SASI_Mm01_00155174 predicted 537
3 SASI_Mm01_00155175 predicted 406
4 SASI_Mm01_00155176 predicted 990
5 SASI_Mm01_00155177 predicted 376
6 SASI_Mm01_00155178 predicted 724
7 SASI_Mm01_00155180 predicted 621
8 SASI_Mm01_00155181 predicted 326
9 SASI_Mm01_00155182 predicted 869
10 SASI_Mm02_00344151 predicted 885
11 SASI_Mm01_00155179 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031925
VALIDATED
TMEM120A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 120A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-434s1c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-183s1c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-182s1c1
Sequence:CCGGGCTGACCAAACTTCAGAACAACTCGAGTTGTTCTGAAGTTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-256s1c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031925.1-764s1c1
Sequence:CCGGGCAGTTTCTCCAGTACTACTACTCGAGTAGTAGTACTGGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-473s21c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-1287s21c1
Sequence:CCGGGGGCCCAGTGCCCTCAATAAACTCGAGTTTATTGAGGGCACTGGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-222s21c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-295s21c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031925
VALIDATED
TMEM120A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 120A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-434s1c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-183s1c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-182s1c1
Sequence:CCGGGCTGACCAAACTTCAGAACAACTCGAGTTGTTCTGAAGTTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-256s1c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031925.1-764s1c1
Sequence:CCGGGCAGTTTCTCCAGTACTACTACTCGAGTAGTAGTACTGGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-473s21c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-1287s21c1
Sequence:CCGGGGGCCCAGTGCCCTCAATAAACTCGAGTTTATTGAGGGCACTGGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-222s21c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-295s21c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031925
VALIDATED
TMEM120A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 120A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-434s1c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-183s1c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-182s1c1
Sequence:CCGGGCTGACCAAACTTCAGAACAACTCGAGTTGTTCTGAAGTTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031925.1-256s1c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031925.1-764s1c1
Sequence:CCGGGCAGTTTCTCCAGTACTACTACTCGAGTAGTAGTACTGGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-473s21c1
Sequence:CCGGGCAGGCTAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_031925.2-1287s21c1
Sequence:CCGGGGGCCCAGTGCCCTCAATAAACTCGAGTTTATTGAGGGCACTGGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-222s21c1
Sequence:CCGGCTGACCAAACTTCAGAACAATCTCGAGATTGTTCTGAAGTTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031925.2-295s21c1
Sequence:CCGGCCCTGAAGAAATGCAAACCCTCTCGAGAGGGTTTGCATTTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172541
VALIDATED
TMEM120A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 120A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-740s21c1
Sequence:CCGGTGTGCAATTCCTGCAGTATTACTCGAGTAATACTGCAGGAATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172541.2-630s21c1
Sequence:CCGGCATCATTATGTGTCCACATTCCTCGAGGAATGTGGACACATAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-431s21c1
Sequence:CCGGCAAAGACGAGTACGAGAAATTCTCGAGAATTTCTCGTACTCGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-595s21c1
Sequence:CCGGACAATGGTTCCAGGATCAAAGCTCGAGCTTTGATCCTGGAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-540s21c1
Sequence:CCGGTTCCTGCTGGTCTGGTATTATCTCGAGATAATACCAGACCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172541
VALIDATED
TMEM120A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 120A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-740s21c1
Sequence:CCGGTGTGCAATTCCTGCAGTATTACTCGAGTAATACTGCAGGAATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172541.2-630s21c1
Sequence:CCGGCATCATTATGTGTCCACATTCCTCGAGGAATGTGGACACATAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-431s21c1
Sequence:CCGGCAAAGACGAGTACGAGAAATTCTCGAGAATTTCTCGTACTCGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-595s21c1
Sequence:CCGGACAATGGTTCCAGGATCAAAGCTCGAGCTTTGATCCTGGAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-540s21c1
Sequence:CCGGTTCCTGCTGGTCTGGTATTATCTCGAGATAATACCAGACCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172541
VALIDATED
TMEM120A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 120A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-740s21c1
Sequence:CCGGTGTGCAATTCCTGCAGTATTACTCGAGTAATACTGCAGGAATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172541.2-630s21c1
Sequence:CCGGCATCATTATGTGTCCACATTCCTCGAGGAATGTGGACACATAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-431s21c1
Sequence:CCGGCAAAGACGAGTACGAGAAATTCTCGAGAATTTCTCGTACTCGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-595s21c1
Sequence:CCGGACAATGGTTCCAGGATCAAAGCTCGAGCTTTGATCCTGGAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172541.2-540s21c1
Sequence:CCGGTTCCTGCTGGTCTGGTATTATCTCGAGATAATACCAGACCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks