EMAIL THIS PAGE TO A FRIEND

TMEM120B

transmembrane protein 120B

UniProtKB ID: A0PK00, A0PK01, B3KX33
Gene ID:
Mouse(330189) transmembrane protein 120B
domestic guinea pig(100725533) transmembrane protein 120B
naked mole-rat(101700735) transmembrane protein 120B
cow(508790) transmembrane protein 120B
sheep(101123070) transmembrane protein 120B
Zebrafish(798580) transmembrane protein 120B
chicken(416847) transmembrane protein 120B
dog(486259) transmembrane protein 120B
domestic cat(101093967) transmembrane protein 120B
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080825 Rosetta Predictions human pricing
NM_001039723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316023 predicted 479
2 SASI_Hs02_00316024 predicted 480
3 SASI_Hs02_00316025 predicted 701
4 SASI_Hs02_00316026 predicted 460
5 SASI_Hs02_00316027 predicted 636
6 SASI_Hs02_00316028 predicted 661
7 SASI_Hs02_00316029 predicted 320
8 SASI_Hs02_00316030 predicted 638
9 SASI_Hs02_00316031 predicted 305
10 SASI_Hs02_00316032 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043552 predicted 378
2 SASI_Mm01_00043553 predicted 782
3 SASI_Mm01_00043554 predicted 1166
4 SASI_Mm01_00043555 predicted 512
5 SASI_Mm01_00043556 predicted 770
6 SASI_Mm01_00043557 predicted 587
7 SASI_Mm01_00043558 predicted 502
8 SASI_Mm02_00290239 predicted 837
9 SASI_Mm01_00043559 predicted 393
10 SASI_Mm01_00043560 predicted 515
11 SASI_Mm01_00043551 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039723
VALIDATED
TMEM120B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 120B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039723.2-590s21c1
Sequence:CCGGGTGTCGATTTGTCCTTCATTACTCGAGTAATGAAGGACAAATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-550s21c1
Sequence:CCGGAGCTCTACCTGACCATAATTCCTCGAGGAATTATGGTCAGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-840s21c1
Sequence:CCGGCAGTTTCTACAGTACTATTACCTCGAGGTAATAGTACTGTAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039723.2-1371s21c1
Sequence:CCGGCCTGTCCCAGCTCCCTATTTACTCGAGTAAATAGGGAGCTGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-766s21c1
Sequence:CCGGCTTGGCCTAATGGACTAATTTCTCGAGAAATTAGTCCATTAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039723
VALIDATED
TMEM120B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 120B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039723.2-590s21c1
Sequence:CCGGGTGTCGATTTGTCCTTCATTACTCGAGTAATGAAGGACAAATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-550s21c1
Sequence:CCGGAGCTCTACCTGACCATAATTCCTCGAGGAATTATGGTCAGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-840s21c1
Sequence:CCGGCAGTTTCTACAGTACTATTACCTCGAGGTAATAGTACTGTAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039723.2-1371s21c1
Sequence:CCGGCCTGTCCCAGCTCCCTATTTACTCGAGTAAATAGGGAGCTGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-766s21c1
Sequence:CCGGCTTGGCCTAATGGACTAATTTCTCGAGAAATTAGTCCATTAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039723
VALIDATED
TMEM120B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 120B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001039723.2-590s21c1
Sequence:CCGGGTGTCGATTTGTCCTTCATTACTCGAGTAATGAAGGACAAATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-550s21c1
Sequence:CCGGAGCTCTACCTGACCATAATTCCTCGAGGAATTATGGTCAGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-840s21c1
Sequence:CCGGCAGTTTCTACAGTACTATTACCTCGAGGTAATAGTACTGTAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039723.2-1371s21c1
Sequence:CCGGCCTGTCCCAGCTCCCTATTTACTCGAGTAAATAGGGAGCTGGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039723.2-766s21c1
Sequence:CCGGCTTGGCCTAATGGACTAATTTCTCGAGAAATTAGTCCATTAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080825
TMEM120B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 120B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080825.2-1658s21c1
Sequence:CCGGGCCACGTGGTGAGGGTTATTTCTCGAGAAATAACCCTCACCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-827s21c1
Sequence:CCGGGCGTCCAGTTCCTGCAATATTCTCGAGAATATTGCAGGAACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-682s21c1
Sequence:CCGGAGCAACGGCTCAAGAATTAAACTCGAGTTTAATTCTTGAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-995s21c1
Sequence:CCGGACAATGCCGTCACGCTGTTTGCTCGAGCAAACAGCGTGACGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-759s21c1
Sequence:CCGGCTGGCCTAATGGACCCATTTACTCGAGTAAATGGGTCCATTAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080825
TMEM120B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 120B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080825.2-1658s21c1
Sequence:CCGGGCCACGTGGTGAGGGTTATTTCTCGAGAAATAACCCTCACCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-827s21c1
Sequence:CCGGGCGTCCAGTTCCTGCAATATTCTCGAGAATATTGCAGGAACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-682s21c1
Sequence:CCGGAGCAACGGCTCAAGAATTAAACTCGAGTTTAATTCTTGAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-995s21c1
Sequence:CCGGACAATGCCGTCACGCTGTTTGCTCGAGCAAACAGCGTGACGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-759s21c1
Sequence:CCGGCTGGCCTAATGGACCCATTTACTCGAGTAAATGGGTCCATTAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080825
TMEM120B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 120B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080825.2-1658s21c1
Sequence:CCGGGCCACGTGGTGAGGGTTATTTCTCGAGAAATAACCCTCACCACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-827s21c1
Sequence:CCGGGCGTCCAGTTCCTGCAATATTCTCGAGAATATTGCAGGAACTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-682s21c1
Sequence:CCGGAGCAACGGCTCAAGAATTAAACTCGAGTTTAATTCTTGAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-995s21c1
Sequence:CCGGACAATGCCGTCACGCTGTTTGCTCGAGCAAACAGCGTGACGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080825.2-759s21c1
Sequence:CCGGCTGGCCTAATGGACCCATTTACTCGAGTAAATGGGTCCATTAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks