EMAIL THIS PAGE TO A FRIEND

TMEM121

transmembrane protein 121

Synonyms: hole
UniProtKB ID: Q9BTD3
Gene ID:
Mouse(69195) transmembrane protein 121
Rat(691678) transmembrane protein 121
chicken(395216) transmembrane protein 121
dog(100682976) transmembrane protein 121
cow(100299951) transmembrane protein 121
naked mole-rat(101715745) transmembrane protein 121
domestic guinea pig(100717516) transmembrane protein 121
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049857 Anti-TMEM121 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042851 MISSION® esiRNA esiRNA targeting mouse Tmem121 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025268 Rosetta Predictions human pricing
XM_001079243 Rosetta Predictions rat pricing
NM_153776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358121 predicted 1252
2 SASI_Hs02_00358122 predicted 1246
3 SASI_Hs02_00358123 predicted 800
4 SASI_Hs02_00358124 predicted 1269
5 SASI_Hs02_00358125 predicted 1272
6 SASI_Hs01_00185864 predicted 678
7 SASI_Hs01_00185865 predicted 687
8 SASI_Hs01_00185867 predicted 681
9 SASI_Hs01_00185869 predicted 774
10 SASI_Hs01_00185870 predicted 683
11 SASI_Hs01_00185866 predicted 681
12 SASI_Hs01_00185868 predicted 768
13 SASI_Hs01_00185871 predicted 772
14 SASI_Hs01_00185872 predicted 779
15 SASI_Hs01_00185873 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363653 predicted 1014
2 SASI_Rn02_00363654 predicted 995
3 SASI_Rn02_00363655 predicted 1072
4 SASI_Rn02_00363656 predicted 986
5 SASI_Rn02_00363657 predicted 1212
6 SASI_Rn02_00363658 predicted 1102
7 SASI_Rn02_00363659 predicted 982
8 SASI_Rn02_00363660 predicted 997
9 SASI_Rn02_00363661 predicted 1066
10 SASI_Rn02_00363662 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343492 predicted 344
2 SASI_Mm02_00343493 predicted 868
3 SASI_Mm01_00074182 predicted 562
4 SASI_Mm01_00074183 predicted 609
5 SASI_Mm02_00343494 predicted 315
6 SASI_Mm02_00343495 predicted 491
7 SASI_Mm02_00343496 predicted 450
8 SASI_Mm02_00343497 predicted 355
9 SASI_Mm01_00074186 predicted 971
10 SASI_Mm02_00343498 predicted 282
11 SASI_Mm01_00074179 predicted 602
12 SASI_Mm01_00074180 predicted 599
13 SASI_Mm01_00074181 predicted 606
14 SASI_Mm01_00074184 predicted 830
15 SASI_Mm01_00074185 predicted 679
16 SASI_Mm01_00074187 predicted 618
17 SASI_Mm01_00074188 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025268
TMEM121 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 121
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-781s21c1
Sequence:CCGGGCCGCAGAAGATGATGCTGTACTCGAGTACAGCATCATCTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-551s21c1
Sequence:CCGGATGGAGTACGTGCGCACCTTCCTCGAGGAAGGTGCGCACGTACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-264s21c1
Sequence:CCGGAGATCGGCGTGTGCATCATCGCTCGAGCGATGATGCACACGCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-758s21c1
Sequence:CCGGAGCATGCAGGGCGAGCACATACTCGAGTATGTGCTCGCCCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-412s1c1
Sequence:CCGGGATCAAGCTCTACTTCATCTTCTCGAGAAGATGAAGTAGAGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-424s1c1
Sequence:CCGGCTTCATCTTCCAGAACTACAACTCGAGTTGTAGTTCTGGAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-376s1c1
Sequence:CCGGCATGATCCTGTGGTTCCTTTACTCGAGTAAAGGAACCACAGGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-375s1c1
Sequence:CCGGCCATGATCCTGTGGTTCCTTTCTCGAGAAAGGAACCACAGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-391s1c1
Sequence:CCGGCCTTTACATCTTCGTGCTGGACTCGAGTCCAGCACGAAGATGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025268.2-1253s1c1
Sequence:CCGGCCGCTTCTTCATCTCAGGAATCTCGAGATTCCTGAGATGAAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-406s1c1
Sequence:CCGGGCTGGAGATCAAGCTCTACTTCTCGAGAAGTAGAGCTTGATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-382s1c1
Sequence:CCGGCCTGTGGTTCCTTTACATCTTCTCGAGAAGATGTAAAGGAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025268
TMEM121 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 121
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-781s21c1
Sequence:CCGGGCCGCAGAAGATGATGCTGTACTCGAGTACAGCATCATCTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-551s21c1
Sequence:CCGGATGGAGTACGTGCGCACCTTCCTCGAGGAAGGTGCGCACGTACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-264s21c1
Sequence:CCGGAGATCGGCGTGTGCATCATCGCTCGAGCGATGATGCACACGCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-758s21c1
Sequence:CCGGAGCATGCAGGGCGAGCACATACTCGAGTATGTGCTCGCCCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-412s1c1
Sequence:CCGGGATCAAGCTCTACTTCATCTTCTCGAGAAGATGAAGTAGAGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-424s1c1
Sequence:CCGGCTTCATCTTCCAGAACTACAACTCGAGTTGTAGTTCTGGAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-376s1c1
Sequence:CCGGCATGATCCTGTGGTTCCTTTACTCGAGTAAAGGAACCACAGGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-375s1c1
Sequence:CCGGCCATGATCCTGTGGTTCCTTTCTCGAGAAAGGAACCACAGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-391s1c1
Sequence:CCGGCCTTTACATCTTCGTGCTGGACTCGAGTCCAGCACGAAGATGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025268.2-1253s1c1
Sequence:CCGGCCGCTTCTTCATCTCAGGAATCTCGAGATTCCTGAGATGAAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-406s1c1
Sequence:CCGGGCTGGAGATCAAGCTCTACTTCTCGAGAAGTAGAGCTTGATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-382s1c1
Sequence:CCGGCCTGTGGTTCCTTTACATCTTCTCGAGAAGATGTAAAGGAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025268
TMEM121 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 121
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-781s21c1
Sequence:CCGGGCCGCAGAAGATGATGCTGTACTCGAGTACAGCATCATCTTCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-551s21c1
Sequence:CCGGATGGAGTACGTGCGCACCTTCCTCGAGGAAGGTGCGCACGTACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-264s21c1
Sequence:CCGGAGATCGGCGTGTGCATCATCGCTCGAGCGATGATGCACACGCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025268.2-758s21c1
Sequence:CCGGAGCATGCAGGGCGAGCACATACTCGAGTATGTGCTCGCCCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-412s1c1
Sequence:CCGGGATCAAGCTCTACTTCATCTTCTCGAGAAGATGAAGTAGAGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-424s1c1
Sequence:CCGGCTTCATCTTCCAGAACTACAACTCGAGTTGTAGTTCTGGAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-376s1c1
Sequence:CCGGCATGATCCTGTGGTTCCTTTACTCGAGTAAAGGAACCACAGGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-375s1c1
Sequence:CCGGCCATGATCCTGTGGTTCCTTTCTCGAGAAAGGAACCACAGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-391s1c1
Sequence:CCGGCCTTTACATCTTCGTGCTGGACTCGAGTCCAGCACGAAGATGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025268.2-1253s1c1
Sequence:CCGGCCGCTTCTTCATCTCAGGAATCTCGAGATTCCTGAGATGAAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025268.2-406s1c1
Sequence:CCGGGCTGGAGATCAAGCTCTACTTCTCGAGAAGTAGAGCTTGATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025268.2-382s1c1
Sequence:CCGGCCTGTGGTTCCTTTACATCTTCTCGAGAAGATGTAAAGGAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153776
TMEM121 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 121
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-629s21c1
Sequence:CCGGGCACTAGACCGCATGGAATATCTCGAGATATTCCATGCGGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-354s21c1
Sequence:CCGGAGATTGGCGTGTGCATAATTGCTCGAGCAATTATGCACACGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-495s21c1
Sequence:CCGGTGCTGGAGATCAAGCTCTATTCTCGAGAATAGAGCTTGATCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-287s21c1
Sequence:CCGGCTGGTGATCATGGGCAGTATGCTCGAGCATACTGCCCATGATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153776.2-1283s21c1
Sequence:CCGGTAGGGACAGGTGTTGTGAATGCTCGAGCATTCACAACACCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153776.1-336s1c1
Sequence:CCGGCGTGTGCATAATTGTGTTGGTCTCGAGACCAACACAATTATGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153776
TMEM121 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 121
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-629s21c1
Sequence:CCGGGCACTAGACCGCATGGAATATCTCGAGATATTCCATGCGGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-354s21c1
Sequence:CCGGAGATTGGCGTGTGCATAATTGCTCGAGCAATTATGCACACGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-495s21c1
Sequence:CCGGTGCTGGAGATCAAGCTCTATTCTCGAGAATAGAGCTTGATCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-287s21c1
Sequence:CCGGCTGGTGATCATGGGCAGTATGCTCGAGCATACTGCCCATGATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153776.2-1283s21c1
Sequence:CCGGTAGGGACAGGTGTTGTGAATGCTCGAGCATTCACAACACCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153776.1-336s1c1
Sequence:CCGGCGTGTGCATAATTGTGTTGGTCTCGAGACCAACACAATTATGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153776
TMEM121 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 121
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-629s21c1
Sequence:CCGGGCACTAGACCGCATGGAATATCTCGAGATATTCCATGCGGTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-354s21c1
Sequence:CCGGAGATTGGCGTGTGCATAATTGCTCGAGCAATTATGCACACGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-495s21c1
Sequence:CCGGTGCTGGAGATCAAGCTCTATTCTCGAGAATAGAGCTTGATCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153776.2-287s21c1
Sequence:CCGGCTGGTGATCATGGGCAGTATGCTCGAGCATACTGCCCATGATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153776.2-1283s21c1
Sequence:CCGGTAGGGACAGGTGTTGTGAATGCTCGAGCATTCACAACACCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153776.1-336s1c1
Sequence:CCGGCGTGTGCATAATTGTGTTGGTCTCGAGACCAACACAATTATGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks