EMAIL THIS PAGE TO A FRIEND

TMEM123

transmembrane protein 123

Synonyms: KCT3 PORIMIN PORMIN
UniProtKB ID: Q8N131, Q8IWS2, Q96QV2
Gene ID:
Human(114908) Summary: This gene encodes a highly glycosylated transmembrane protein with a high content of threonine and serine residues in its extracellular domain, similar to a broadly defined category of proteins termed mucins. Exposure of some cell types to anti-PORIMIN (pro-oncosis receptor inducing membrane injury) antibody, crosslinks this protein on the cell surface and induces a type of cell death termed oncosis. Oncosis is distinct from apoptosis and is characterized by a loss of cell membrane integrity without DNA fragmentation. This gene product is proposed to function as a cell surface receptor that mediates cell death. [provided by RefSeq, Jul 2008]
Mouse(71929) transmembrane protein 123
Rat(363013) transmembrane protein 123
naked mole-rat(101698744) transmembrane protein 123
cow(100300021) transmembrane protein 123
Zebrafish(561344) transmembrane protein 123
dog(611863) transmembrane protein 123
chicken(418984) transmembrane protein 123
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052932 Rosetta Predictions human pricing
NM_001014205 Rosetta Predictions rat pricing
NM_133739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032049 predicted 611
2 SASI_Hs01_00032050 predicted 1070
3 SASI_Hs01_00032051 predicted 549
4 SASI_Hs01_00032052 predicted 640
5 SASI_Hs01_00032053 predicted 796
6 SASI_Hs01_00032054 predicted 875
7 SASI_Hs01_00032056 predicted 747
8 SASI_Hs01_00032057 predicted 837
9 SASI_Hs01_00032058 predicted 528
10 SASI_Hs02_00361711 predicted 825
11 SASI_Hs01_00032055 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111770 predicted 727
2 SASI_Rn01_00111771 predicted 468
3 SASI_Rn01_00111772 predicted 661
4 SASI_Rn01_00111773 predicted 862
5 SASI_Rn01_00111775 predicted 510
6 SASI_Rn01_00111776 predicted 812
7 SASI_Rn01_00111777 predicted 871
8 SASI_Rn01_00111779 predicted 930
9 SASI_Rn02_00201730 predicted 232
10 SASI_Rn02_00201731 predicted 659
11 SASI_Rn01_00111774 predicted 680
12 SASI_Rn01_00111778 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148454 predicted 933
2 SASI_Mm01_00148455 predicted 621
3 SASI_Mm01_00148457 predicted 966
4 SASI_Mm02_00338719 predicted 786
5 SASI_Mm02_00338720 predicted 382
6 SASI_Mm01_00148462 predicted 835
7 SASI_Mm02_00338721 predicted 367
8 SASI_Mm02_00338722 predicted 705
9 SASI_Mm02_00338723 predicted 546
10 SASI_Mm02_00338724 predicted 944
11 SASI_Mm01_00148453 predicted 818
12 SASI_Mm01_00148456 predicted 872
13 SASI_Mm01_00148458 predicted 785
14 SASI_Mm01_00148459 predicted 683
15 SASI_Mm01_00148460 predicted 900
16 SASI_Mm01_00148461 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133739
TMEM123 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 123
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-661s1c2
Sequence:CCGGCGAACATGATGCCATCATTTACTCGAGTAAATGATGGCATCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133739.1-789s1c1
Sequence:CCGGGCATATAATGAGCAGTGTATTCTCGAGAATACACTGCTCATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-649s1c1
Sequence:CCGGCCGAAGCATTGACGAACATGACTCGAGTCATGTTCGTCAATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-622s1c1
Sequence:CCGGGTATTATTCAAGAAGAGGCATCTCGAGATGCCTCTTCTTGAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133739
TMEM123 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 123
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-661s1c2
Sequence:CCGGCGAACATGATGCCATCATTTACTCGAGTAAATGATGGCATCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133739.1-789s1c1
Sequence:CCGGGCATATAATGAGCAGTGTATTCTCGAGAATACACTGCTCATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-649s1c1
Sequence:CCGGCCGAAGCATTGACGAACATGACTCGAGTCATGTTCGTCAATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-622s1c1
Sequence:CCGGGTATTATTCAAGAAGAGGCATCTCGAGATGCCTCTTCTTGAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133739
TMEM123 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 123
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-661s1c2
Sequence:CCGGCGAACATGATGCCATCATTTACTCGAGTAAATGATGGCATCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133739.1-789s1c1
Sequence:CCGGGCATATAATGAGCAGTGTATTCTCGAGAATACACTGCTCATTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-649s1c1
Sequence:CCGGCCGAAGCATTGACGAACATGACTCGAGTCATGTTCGTCAATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133739.1-622s1c1
Sequence:CCGGGTATTATTCAAGAAGAGGCATCTCGAGATGCCTCTTCTTGAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052932
VALIDATED
TMEM123 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 123
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-754s1c1
Sequence:CCGGCGAACCATAGATGAACATGATCTCGAGATCATGTTCATCTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-566s1c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-627s1c1
Sequence:CCGGTGAAGCAAAGAAAGGATCAAACTCGAGTTTGATCCTTTCTTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-489s1c1
Sequence:CCGGCACCTTAAAGTCTACACCCAACTCGAGTTGGGTGTAGACTTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-338s1c1
Sequence:CCGGCTGACCATACAAATGAAACTTCTCGAGAAGTTTCATTTGTATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-593s21c1
Sequence:CCGGGTGCCTTCTGACCATACAAATCTCGAGATTTGTATGGTCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-1028s21c1
Sequence:CCGGGAACATGATGCCATCATTTAACTCGAGTTAAATGATGGCATCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-652s21c1
Sequence:CCGGTGCCTCAGACTCCAGTAATACCTCGAGGTATTACTGGAGTCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-828s21c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052932.2-1527s21c1
Sequence:CCGGACTAGATCTGAAGCATAATTTCTCGAGAAATTATGCTTCAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052932
VALIDATED
TMEM123 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 123
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-754s1c1
Sequence:CCGGCGAACCATAGATGAACATGATCTCGAGATCATGTTCATCTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-566s1c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-627s1c1
Sequence:CCGGTGAAGCAAAGAAAGGATCAAACTCGAGTTTGATCCTTTCTTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-489s1c1
Sequence:CCGGCACCTTAAAGTCTACACCCAACTCGAGTTGGGTGTAGACTTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-338s1c1
Sequence:CCGGCTGACCATACAAATGAAACTTCTCGAGAAGTTTCATTTGTATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-593s21c1
Sequence:CCGGGTGCCTTCTGACCATACAAATCTCGAGATTTGTATGGTCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-1028s21c1
Sequence:CCGGGAACATGATGCCATCATTTAACTCGAGTTAAATGATGGCATCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-652s21c1
Sequence:CCGGTGCCTCAGACTCCAGTAATACCTCGAGGTATTACTGGAGTCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-828s21c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052932.2-1527s21c1
Sequence:CCGGACTAGATCTGAAGCATAATTTCTCGAGAAATTATGCTTCAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052932
VALIDATED
TMEM123 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 123
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-754s1c1
Sequence:CCGGCGAACCATAGATGAACATGATCTCGAGATCATGTTCATCTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-566s1c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-627s1c1
Sequence:CCGGTGAAGCAAAGAAAGGATCAAACTCGAGTTTGATCCTTTCTTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052932.1-489s1c1
Sequence:CCGGCACCTTAAAGTCTACACCCAACTCGAGTTGGGTGTAGACTTTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_052932.1-338s1c1
Sequence:CCGGCTGACCATACAAATGAAACTTCTCGAGAAGTTTCATTTGTATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-593s21c1
Sequence:CCGGGTGCCTTCTGACCATACAAATCTCGAGATTTGTATGGTCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-1028s21c1
Sequence:CCGGGAACATGATGCCATCATTTAACTCGAGTTAAATGATGGCATCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-652s21c1
Sequence:CCGGTGCCTCAGACTCCAGTAATACCTCGAGGTATTACTGGAGTCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052932.2-828s21c1
Sequence:CCGGCCCACAATAGTTCAGTGACATCTCGAGATGTCACTGAACTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052932.2-1527s21c1
Sequence:CCGGACTAGATCTGAAGCATAATTTCTCGAGAAATTATGCTTCAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks