EMAIL THIS PAGE TO A FRIEND

TMEM125

transmembrane protein 125

UniProtKB ID: Q96AQ2, D3DPX1
Gene ID:
Mouse(230678) transmembrane protein 125
Rat(313545) transmembrane protein 125
chicken(424560) transmembrane protein 125
dog(610813) transmembrane protein 125
domestic cat(101080468) transmembrane protein 125
cow(509101) transmembrane protein 125
sheep(101108965) transmembrane protein 125
naked mole-rat(101701142) transmembrane protein 125
domestic guinea pig(100717705) transmembrane protein 125
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144626 Rosetta Predictions human pricing
NM_001107967 Rosetta Predictions rat pricing
NM_172383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364448 predicted 1280
2 SASI_Hs02_00364449 predicted 1328
3 SASI_Hs01_00189418 predicted 1183
4 SASI_Hs02_00364450 predicted 1072
5 SASI_Hs01_00189420 predicted 1171
6 SASI_Hs01_00189421 predicted 1144
7 SASI_Hs02_00364451 predicted 1377
8 SASI_Hs02_00364452 predicted 1274
9 SASI_Hs01_00189423 predicted 405
10 SASI_Hs01_00189426 predicted 982
11 SASI_Hs01_00189419 predicted 1084
12 SASI_Hs01_00189422 predicted 1135
13 SASI_Hs01_00189424 predicted 1132
14 SASI_Hs01_00189425 predicted 1001
15 SASI_Hs01_00189427 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234055 predicted 718
2 SASI_Rn02_00234056 predicted 1143
3 SASI_Rn02_00234057 predicted 497
4 SASI_Rn02_00234058 predicted 862
5 SASI_Rn02_00234059 predicted 435
6 SASI_Rn02_00234060 predicted 392
7 SASI_Rn02_00234061 predicted 837
8 SASI_Rn02_00234062 predicted 850
9 SASI_Rn02_00234063 predicted 1095
10 SASI_Rn02_00234064 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086902 predicted 1548
2 SASI_Mm02_00343824 predicted 1443
3 SASI_Mm01_00086905 predicted 1484
4 SASI_Mm01_00086906 predicted 1277
5 SASI_Mm01_00086907 predicted 1477
6 SASI_Mm01_00086908 predicted 1575
7 SASI_Mm01_00086909 predicted 1573
8 SASI_Mm01_00086911 predicted 1127
9 SASI_Mm02_00343825 predicted 1126
10 SASI_Mm02_00343826 predicted 1004
11 SASI_Mm01_00086903 predicted 1364
12 SASI_Mm01_00086904 predicted 1421
13 SASI_Mm01_00086910 predicted 1579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144626
TMEM125 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 125
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144626.2-1004s21c1
Sequence:CCGGGCTGTATCAAGTGGGTGTGAGCTCGAGCTCACACCCACTTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1231s21c1
Sequence:CCGGAGTGCATGTGAACGTTGAGTACTCGAGTACTCAACGTTCACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1298s21c1
Sequence:CCGGATTGCATGGCGTGTGATTAAACTCGAGTTTAATCACACGCCATGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-600s1c1
Sequence:CCGGGTTCTGGTGAAACAGCTGATGCTCGAGCATCAGCTGTTTCACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144626.1-1353s1c1
Sequence:CCGGCATCCATCAAGGATTTCCATACTCGAGTATGGAAATCCTTGATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-947s1c1
Sequence:CCGGCTTCAGCATCTCAGGACAGTTCTCGAGAACTGTCCTGAGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144626
TMEM125 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 125
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144626.2-1004s21c1
Sequence:CCGGGCTGTATCAAGTGGGTGTGAGCTCGAGCTCACACCCACTTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1231s21c1
Sequence:CCGGAGTGCATGTGAACGTTGAGTACTCGAGTACTCAACGTTCACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1298s21c1
Sequence:CCGGATTGCATGGCGTGTGATTAAACTCGAGTTTAATCACACGCCATGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-600s1c1
Sequence:CCGGGTTCTGGTGAAACAGCTGATGCTCGAGCATCAGCTGTTTCACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144626.1-1353s1c1
Sequence:CCGGCATCCATCAAGGATTTCCATACTCGAGTATGGAAATCCTTGATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-947s1c1
Sequence:CCGGCTTCAGCATCTCAGGACAGTTCTCGAGAACTGTCCTGAGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144626
TMEM125 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 125
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144626.2-1004s21c1
Sequence:CCGGGCTGTATCAAGTGGGTGTGAGCTCGAGCTCACACCCACTTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1231s21c1
Sequence:CCGGAGTGCATGTGAACGTTGAGTACTCGAGTACTCAACGTTCACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144626.2-1298s21c1
Sequence:CCGGATTGCATGGCGTGTGATTAAACTCGAGTTTAATCACACGCCATGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-600s1c1
Sequence:CCGGGTTCTGGTGAAACAGCTGATGCTCGAGCATCAGCTGTTTCACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144626.1-1353s1c1
Sequence:CCGGCATCCATCAAGGATTTCCATACTCGAGTATGGAAATCCTTGATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144626.1-947s1c1
Sequence:CCGGCTTCAGCATCTCAGGACAGTTCTCGAGAACTGTCCTGAGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172383
TMEM125 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 125
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.3-832s1c1
Sequence:CCGGGTGCAGGATATGAACTGCATACTCGAGTATGCAGTTCATATCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1133s21c1
Sequence:CCGGGTGATAACAGTAGCATCTTTACTCGAGTAAAGATGCTACTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172383.3-1480s21c1
Sequence:CCGGTGAAGACTTGACCCATATTTCCTCGAGGAAATATGGGTCAAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1168s21c1
Sequence:CCGGTTGTCTTCTGGCCAGCGTCATCTCGAGATGACGCTGGCCAGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-826s21c1
Sequence:CCGGTCTGCCGTGCAGGATATGAACCTCGAGGTTCATATCCTGCACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1095s21c1
Sequence:CCGGGATCTGTACAGAGGCATTCTCCTCGAGGAGAATGCCTCTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172383.1-1414s1c1
Sequence:CCGGGTTTGTATCATGGACTGTCATCTCGAGATGACAGTCCATGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.1-1135s1c1
Sequence:CCGGCAGTGATAACAGTAGCATCTTCTCGAGAAGATGCTACTGTTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172383
TMEM125 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 125
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.3-832s1c1
Sequence:CCGGGTGCAGGATATGAACTGCATACTCGAGTATGCAGTTCATATCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1133s21c1
Sequence:CCGGGTGATAACAGTAGCATCTTTACTCGAGTAAAGATGCTACTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172383.3-1480s21c1
Sequence:CCGGTGAAGACTTGACCCATATTTCCTCGAGGAAATATGGGTCAAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1168s21c1
Sequence:CCGGTTGTCTTCTGGCCAGCGTCATCTCGAGATGACGCTGGCCAGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-826s21c1
Sequence:CCGGTCTGCCGTGCAGGATATGAACCTCGAGGTTCATATCCTGCACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1095s21c1
Sequence:CCGGGATCTGTACAGAGGCATTCTCCTCGAGGAGAATGCCTCTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172383.1-1414s1c1
Sequence:CCGGGTTTGTATCATGGACTGTCATCTCGAGATGACAGTCCATGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.1-1135s1c1
Sequence:CCGGCAGTGATAACAGTAGCATCTTCTCGAGAAGATGCTACTGTTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172383
TMEM125 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 125
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.3-832s1c1
Sequence:CCGGGTGCAGGATATGAACTGCATACTCGAGTATGCAGTTCATATCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1133s21c1
Sequence:CCGGGTGATAACAGTAGCATCTTTACTCGAGTAAAGATGCTACTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172383.3-1480s21c1
Sequence:CCGGTGAAGACTTGACCCATATTTCCTCGAGGAAATATGGGTCAAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1168s21c1
Sequence:CCGGTTGTCTTCTGGCCAGCGTCATCTCGAGATGACGCTGGCCAGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-826s21c1
Sequence:CCGGTCTGCCGTGCAGGATATGAACCTCGAGGTTCATATCCTGCACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172383.3-1095s21c1
Sequence:CCGGGATCTGTACAGAGGCATTCTCCTCGAGGAGAATGCCTCTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172383.1-1414s1c1
Sequence:CCGGGTTTGTATCATGGACTGTCATCTCGAGATGACAGTCCATGATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172383.1-1135s1c1
Sequence:CCGGCAGTGATAACAGTAGCATCTTCTCGAGAAGATGCTACTGTTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks