EMAIL THIS PAGE TO A FRIEND

TMEM126A

transmembrane protein 126A

Synonyms: OPA7
UniProtKB ID: Q9H061, B2R570, E9PI16
Gene ID:
Human(84233) Summary: The protein encoded by this gene is a mitochondrial membrane protein of unknown function. Defects in this gene are a cause of optic atrophy type 7 (OPA7). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(66271) transmembrane protein 126A
Rat(293113) transmembrane protein 126A
Zebrafish(393771) transmembrane protein 126A
chicken(426392) transmembrane protein 126A
dog(608427) transmembrane protein 126A
domestic cat(101097414) transmembrane protein 126A
domestic guinea pig(100730174) transmembrane protein 126A
naked mole-rat(101710322) transmembrane protein 126A
cow(529762) transmembrane protein 126A
sheep(101104354) transmembrane protein 126A
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032273 Rosetta Predictions human pricing
NM_001011557 Rosetta Predictions rat pricing
NM_025460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094871 predicted 424
2 SASI_Hs01_00094872 predicted 406
3 SASI_Hs01_00094873 predicted 480
4 SASI_Hs01_00094874 predicted 408
5 SASI_Hs01_00094875 predicted 299
6 SASI_Hs01_00094876 predicted 333
7 SASI_Hs01_00094877 predicted 280
8 SASI_Hs01_00094878 predicted 410
9 SASI_Hs01_00094879 predicted 225
10 SASI_Hs01_00094880 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099573 predicted 582
2 SASI_Rn01_00099574 predicted 333
3 SASI_Rn01_00099575 predicted 717
4 SASI_Rn01_00099576 predicted 741
5 SASI_Rn01_00099577 predicted 627
6 SASI_Rn01_00099578 predicted 358
7 SASI_Rn01_00099580 predicted 505
8 SASI_Rn01_00099581 predicted 612
9 SASI_Rn01_00099582 predicted 640
10 SASI_Rn02_00199844 predicted 915
11 SASI_Rn01_00099579 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085694 predicted 317
2 SASI_Mm01_00085695 predicted 294
3 SASI_Mm02_00328295 predicted 220
4 SASI_Mm02_00328296 predicted 301
5 SASI_Mm02_00328297 predicted 222
6 SASI_Mm02_00328298 predicted 280
7 SASI_Mm01_00085692 predicted 231
8 SASI_Mm01_00085693 predicted 435
9 SASI_Mm01_00085696 predicted 384
10 SASI_Mm01_00085698 predicted 245
11 SASI_Mm01_00085691 predicted 468
12 SASI_Mm01_00085697 predicted 226
13 SASI_Mm01_00085699 predicted 330
14 SASI_Mm01_00085700 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032273
VALIDATED
TMEM126A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 126A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-607s1c1
Sequence:CCGGGCATACCTTGGGTCTGAACAACTCGAGTTGTTCAGACCCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-166s1c1
Sequence:CCGGCTTCCAGAAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-169s1c1
Sequence:CCGGCCAGAAGCAGAAAGGAATCTACTCGAGTAGATTCCTTTCTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-507s1c1
Sequence:CCGGGTTACCACACAAAGGGAACATCTCGAGATGTTCCCTTTGTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-211s1c1
Sequence:CCGGGTTGGATTAAATGCTGCTCTTCTCGAGAAGAGCAGCATTTAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-555s1c1
Sequence:CCGGGCCTGTCTTTAGAAAGATGTTCTCGAGAACATCTTTCTAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-540s1c1
Sequence:CCGGGATTAGAACTTCTAAGCCTGTCTCGAGACAGGCTTAGAAGTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-260s1c1
Sequence:CCGGGACGCATCTTGAATGTGACAACTCGAGTTGTCACATTCAAGATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-460s1c1
Sequence:CCGGGCTATACCTGTAAATGGTGGTCTCGAGACCACCATTTACAGGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032273
VALIDATED
TMEM126A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 126A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-607s1c1
Sequence:CCGGGCATACCTTGGGTCTGAACAACTCGAGTTGTTCAGACCCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-166s1c1
Sequence:CCGGCTTCCAGAAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-169s1c1
Sequence:CCGGCCAGAAGCAGAAAGGAATCTACTCGAGTAGATTCCTTTCTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-507s1c1
Sequence:CCGGGTTACCACACAAAGGGAACATCTCGAGATGTTCCCTTTGTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-211s1c1
Sequence:CCGGGTTGGATTAAATGCTGCTCTTCTCGAGAAGAGCAGCATTTAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-555s1c1
Sequence:CCGGGCCTGTCTTTAGAAAGATGTTCTCGAGAACATCTTTCTAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-540s1c1
Sequence:CCGGGATTAGAACTTCTAAGCCTGTCTCGAGACAGGCTTAGAAGTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-260s1c1
Sequence:CCGGGACGCATCTTGAATGTGACAACTCGAGTTGTCACATTCAAGATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-460s1c1
Sequence:CCGGGCTATACCTGTAAATGGTGGTCTCGAGACCACCATTTACAGGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032273
VALIDATED
TMEM126A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 126A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-607s1c1
Sequence:CCGGGCATACCTTGGGTCTGAACAACTCGAGTTGTTCAGACCCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-166s1c1
Sequence:CCGGCTTCCAGAAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-169s1c1
Sequence:CCGGCCAGAAGCAGAAAGGAATCTACTCGAGTAGATTCCTTTCTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-507s1c1
Sequence:CCGGGTTACCACACAAAGGGAACATCTCGAGATGTTCCCTTTGTGTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-211s1c1
Sequence:CCGGGTTGGATTAAATGCTGCTCTTCTCGAGAAGAGCAGCATTTAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-555s1c1
Sequence:CCGGGCCTGTCTTTAGAAAGATGTTCTCGAGAACATCTTTCTAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032273.2-540s1c1
Sequence:CCGGGATTAGAACTTCTAAGCCTGTCTCGAGACAGGCTTAGAAGTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-260s1c1
Sequence:CCGGGACGCATCTTGAATGTGACAACTCGAGTTGTCACATTCAAGATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032273.2-460s1c1
Sequence:CCGGGCTATACCTGTAAATGGTGGTCTCGAGACCACCATTTACAGGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025460
TMEM126A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 126A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-393s1c1
Sequence:CCGGCCTACCAAAGTCTTGTAAGTTCTCGAGAACTTACAAGACTTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-334s1c1
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-586s1c1
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-314s1c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-288s1c1
Sequence:CCGGGCCTAATAGCAAACAGTCTATCTCGAGATAGACTGTTTGCTATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-313s21c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-585s21c3
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-333s21c2
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-230s21c1
Sequence:CCGGACAGGAATCTGCTTGAATATGCTCGAGCATATTCAAGCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-252s21c1
Sequence:CCGGATCAGCATATATTGGACTTAACTCGAGTTAAGTCCAATATATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025460
TMEM126A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 126A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-393s1c1
Sequence:CCGGCCTACCAAAGTCTTGTAAGTTCTCGAGAACTTACAAGACTTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-334s1c1
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-586s1c1
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-314s1c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-288s1c1
Sequence:CCGGGCCTAATAGCAAACAGTCTATCTCGAGATAGACTGTTTGCTATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-313s21c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-585s21c3
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-333s21c2
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-230s21c1
Sequence:CCGGACAGGAATCTGCTTGAATATGCTCGAGCATATTCAAGCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-252s21c1
Sequence:CCGGATCAGCATATATTGGACTTAACTCGAGTTAAGTCCAATATATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025460
TMEM126A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 126A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-393s1c1
Sequence:CCGGCCTACCAAAGTCTTGTAAGTTCTCGAGAACTTACAAGACTTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-334s1c1
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-586s1c1
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-314s1c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025460.1-288s1c1
Sequence:CCGGGCCTAATAGCAAACAGTCTATCTCGAGATAGACTGTTTGCTATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-313s21c1
Sequence:CCGGCGAATCTTGAACGTGACACAACTCGAGTTGTGTCACGTTCAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-585s21c3
Sequence:CCGGCTACTGGATTACAGTTTCTAACTCGAGTTAGAAACTGTAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-333s21c2
Sequence:CCGGAGCTCGATTAGCTTCTAGCTTCTCGAGAAGCTAGAAGCTAATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-230s21c1
Sequence:CCGGACAGGAATCTGCTTGAATATGCTCGAGCATATTCAAGCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025460.2-252s21c1
Sequence:CCGGATCAGCATATATTGGACTTAACTCGAGTTAAGTCCAATATATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks