EMAIL THIS PAGE TO A FRIEND

TMEM126B

transmembrane protein 126B

Gene ID:
Mouse(68472) transmembrane protein 126B
Rat(293114) transmembrane protein 126B
cow(504229) transmembrane protein 126B
sheep(101104615) transmembrane protein 126B
naked mole-rat(101711031) transmembrane protein 126B
domestic guinea pig(100732563) transmembrane protein 126B
dog(485156) transmembrane protein 126B-like
domestic cat(101097665) transmembrane protein 126B
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089791 MISSION® esiRNA esiRNA human TMEM126B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018480 Rosetta Predictions human pricing
NM_001106280 Rosetta Predictions rat pricing
NM_026734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220296 predicted 535
2 SASI_Hs01_00220297 predicted 444
3 SASI_Hs01_00220298 predicted 732
4 SASI_Hs01_00220299 predicted 724
5 SASI_Hs01_00220300 predicted 299
6 SASI_Hs01_00220301 predicted 767
7 SASI_Hs01_00220302 predicted 308
8 SASI_Hs01_00220303 predicted 544
9 SASI_Hs02_00352070 predicted 538
10 SASI_Hs01_00220304 predicted 791
11 SASI_Hs01_00220305 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217418 predicted 227
2 SASI_Rn02_00217419 predicted 616
3 SASI_Rn02_00217420 predicted 207
4 SASI_Rn02_00217421 predicted 289
5 SASI_Rn02_00217422 predicted 267
6 SASI_Rn02_00217423 predicted 313
7 SASI_Rn02_00217424 predicted 248
8 SASI_Rn02_00217425 predicted 520
9 SASI_Rn02_00217426 predicted 553
10 SASI_Rn02_00217427 predicted 192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330777 predicted 218
2 SASI_Mm01_00032544 predicted 260
3 SASI_Mm01_00032545 predicted 244
4 SASI_Mm01_00032546 predicted 440
5 SASI_Mm01_00032547 predicted 205
6 SASI_Mm01_00032548 predicted 389
7 SASI_Mm01_00032549 predicted 608
8 SASI_Mm02_00330778 predicted 298
9 SASI_Mm02_00330779 predicted 321
10 SASI_Mm01_00032550 predicted 553
11 SASI_Mm01_00032543 predicted 245
12 SASI_Mm01_00032551 predicted 346
13 SASI_Mm01_00032552 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018480
VALIDATED
TMEM126B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 126B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-313s21c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-723s21c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-593s21c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-445s21c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018480.2-911s21c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-911s1c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-593s1c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-723s1c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-313s1c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-445s1c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018480
VALIDATED
TMEM126B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 126B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-313s21c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-723s21c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-593s21c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-445s21c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018480.2-911s21c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-911s1c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-593s1c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-723s1c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-313s1c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-445s1c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018480
VALIDATED
TMEM126B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 126B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-313s21c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-723s21c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-593s21c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018480.2-445s21c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018480.2-911s21c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-911s1c1
Sequence:CCGGCAGGCATTGCTGAAAGAGTTACTCGAGTAACTCTTTCAGCAATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-593s1c1
Sequence:CCGGGCTCACTGATTGGCATAGTTTCTCGAGAAACTATGCCAATCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-723s1c1
Sequence:CCGGGACGCTTTGTCAAACACAAATCTCGAGATTTGTGTTTGACAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-313s1c1
Sequence:CCGGCCAATGGTCATAGAAATCATACTCGAGTATGATTTCTATGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018480.2-445s1c1
Sequence:CCGGCGCTGCTTCAAGGTTAAACATCTCGAGATGTTTAACCTTGAAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026734
TMEM126B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 126B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-299s1c1
Sequence:CCGGCCGAAACAGTTTCAAGGTTAACTCGAGTTAACCTTGAAACTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-652s1c1
Sequence:CCGGCTGGCTTACATCATTACAATACTCGAGTATTGTAATGATGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-251s1c1
Sequence:CCGGCTTTGGAACAAGTAGTAGTTTCTCGAGAAACTACTACTTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-548s1c1
Sequence:CCGGGCCACCAAAGGGAAGAGTTATCTCGAGATAACTCTTCCCTTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-166s1c1
Sequence:CCGGGAAGCCCGATAATCTCTGAAACTCGAGTTTCAGAGATTATCGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026734
TMEM126B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 126B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-299s1c1
Sequence:CCGGCCGAAACAGTTTCAAGGTTAACTCGAGTTAACCTTGAAACTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-652s1c1
Sequence:CCGGCTGGCTTACATCATTACAATACTCGAGTATTGTAATGATGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-251s1c1
Sequence:CCGGCTTTGGAACAAGTAGTAGTTTCTCGAGAAACTACTACTTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-548s1c1
Sequence:CCGGGCCACCAAAGGGAAGAGTTATCTCGAGATAACTCTTCCCTTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-166s1c1
Sequence:CCGGGAAGCCCGATAATCTCTGAAACTCGAGTTTCAGAGATTATCGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026734
TMEM126B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 126B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-299s1c1
Sequence:CCGGCCGAAACAGTTTCAAGGTTAACTCGAGTTAACCTTGAAACTGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-652s1c1
Sequence:CCGGCTGGCTTACATCATTACAATACTCGAGTATTGTAATGATGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-251s1c1
Sequence:CCGGCTTTGGAACAAGTAGTAGTTTCTCGAGAAACTACTACTTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-548s1c1
Sequence:CCGGGCCACCAAAGGGAAGAGTTATCTCGAGATAACTCTTCCCTTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026734.1-166s1c1
Sequence:CCGGGAAGCCCGATAATCTCTGAAACTCGAGTTTCAGAGATTATCGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks