EMAIL THIS PAGE TO A FRIEND

TMEM127

transmembrane protein 127

UniProtKB ID: O75204, D3DXH0
Gene ID:
Human(55654) Summary: This gene encodes a transmembrane protein with 3 predicted transmembrane domains. The protein is associated with a subpopulation of vesicular organelles corresponding to early endosomal structures, with the Golgi, and with lysosomes, and may participate in protein trafficking between these structures. Mutations in this gene and several other genes cause pheochromocytomas. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2010]
Mouse(69470) transmembrane protein 127
Rat(311405) transmembrane protein 127
Zebrafish(553545) transmembrane protein 127
domestic cat(101091188) transmembrane protein 127
dog(609057) transmembrane protein 127
chicken(100857207) transmembrane protein 127
domestic guinea pig(100715704) transmembrane protein 127
naked mole-rat(101702991) transmembrane protein 127
cow(513620) transmembrane protein 127
sheep(101113833) transmembrane protein 127
210 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102452 Anti-TMEM127 antibody produced in rabbit affinity isolated antibody bovine, rat, horse, mouse, zebrafish, canine, human, guinea pig, rabbit,
western blot pricing
HPA042359 Anti-TMEM127 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129631 MISSION® esiRNA esiRNA human TMEM127 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017849 Rosetta Predictions human pricing
NM_001100978 Rosetta Predictions rat pricing
NM_175145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026454 predicted 600
2 SASI_Hs01_00026455 predicted 822
3 SASI_Hs01_00026456 predicted 916
4 SASI_Hs01_00026457 predicted 490
5 SASI_Hs01_00026458 predicted 744
6 SASI_Hs01_00026459 predicted 581
7 SASI_Hs01_00026460 predicted 775
8 SASI_Hs01_00026461 predicted 634
9 SASI_Hs01_00026462 predicted 534
10 SASI_Hs02_00350745 predicted 1389
11 SASI_Hs01_00026463 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210922 predicted 862
2 SASI_Rn02_00210923 predicted 1303
3 SASI_Rn02_00210924 predicted 780
4 SASI_Rn02_00210925 predicted 256
5 SASI_Rn02_00210926 predicted 1393
6 SASI_Rn02_00210927 predicted 550
7 SASI_Rn02_00210928 predicted 1267
8 SASI_Rn02_00210929 predicted 421
9 SASI_Rn02_00210930 predicted 1241
10 SASI_Rn02_00210931 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022506 predicted 839
2 SASI_Mm02_00345783 predicted 1309
3 SASI_Mm01_00022507 predicted 1037
4 SASI_Mm01_00022508 predicted 1308
5 SASI_Mm01_00022509 predicted 1081
6 SASI_Mm01_00022510 predicted 1373
7 SASI_Mm01_00022511 predicted 1329
8 SASI_Mm01_00022512 predicted 878
9 SASI_Mm01_00022513 predicted 1388
10 SASI_Mm02_00345784 predicted 1400
11 SASI_Mm01_00022514 predicted 852
12 SASI_Mm01_00022515 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175145
VALIDATED
TMEM127 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 127
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175145.2-2491s1c1
Sequence:CCGGGCCAGAAAGAATGGTGAATATCTCGAGATATTCACCATTCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175145.2-335s1c1
Sequence:CCGGCCCGCTTGGTTGCACATCCATCTCGAGATGGATGTGCAACCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-844s1c1
Sequence:CCGGCCCAGCAGAGTATGAGGTCATCTCGAGATGACCTCATACTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-700s1c1
Sequence:CCGGCTTTGCTGTTAGCTTCTACTTCTCGAGAAGTAGAAGCTAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-551s1c1
Sequence:CCGGCTGAAGATTACTCGTCGGTATCTCGAGATACCGACGAGTAATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175145
VALIDATED
TMEM127 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 127
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175145.2-2491s1c1
Sequence:CCGGGCCAGAAAGAATGGTGAATATCTCGAGATATTCACCATTCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175145.2-335s1c1
Sequence:CCGGCCCGCTTGGTTGCACATCCATCTCGAGATGGATGTGCAACCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-844s1c1
Sequence:CCGGCCCAGCAGAGTATGAGGTCATCTCGAGATGACCTCATACTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-700s1c1
Sequence:CCGGCTTTGCTGTTAGCTTCTACTTCTCGAGAAGTAGAAGCTAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-551s1c1
Sequence:CCGGCTGAAGATTACTCGTCGGTATCTCGAGATACCGACGAGTAATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175145
VALIDATED
TMEM127 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 127
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175145.2-2491s1c1
Sequence:CCGGGCCAGAAAGAATGGTGAATATCTCGAGATATTCACCATTCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175145.2-335s1c1
Sequence:CCGGCCCGCTTGGTTGCACATCCATCTCGAGATGGATGTGCAACCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-844s1c1
Sequence:CCGGCCCAGCAGAGTATGAGGTCATCTCGAGATGACCTCATACTCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-700s1c1
Sequence:CCGGCTTTGCTGTTAGCTTCTACTTCTCGAGAAGTAGAAGCTAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175145.2-551s1c1
Sequence:CCGGCTGAAGATTACTCGTCGGTATCTCGAGATACCGACGAGTAATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017849
TMEM127 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 127
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000432536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1118s21c1
Sequence:CCGGCTTTAGGGTCATCCAAGTATCCTCGAGGATACTTGGATGACCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1236s21c1
Sequence:CCGGAGGGAAGGTCATCCAAGTTTCCTCGAGGAAACTTGGATGACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017849.1-670s21c1
Sequence:CCGGTGCAGTGTGCCACCGTCATTGCTCGAGCAATGACGGTGGCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017849
TMEM127 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 127
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000432536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1118s21c1
Sequence:CCGGCTTTAGGGTCATCCAAGTATCCTCGAGGATACTTGGATGACCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1236s21c1
Sequence:CCGGAGGGAAGGTCATCCAAGTTTCCTCGAGGAAACTTGGATGACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017849.1-670s21c1
Sequence:CCGGTGCAGTGTGCCACCGTCATTGCTCGAGCAATGACGGTGGCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017849
TMEM127 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 127
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000432536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1118s21c1
Sequence:CCGGCTTTAGGGTCATCCAAGTATCCTCGAGGATACTTGGATGACCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017849.1-1236s21c1
Sequence:CCGGAGGGAAGGTCATCCAAGTTTCCTCGAGGAAACTTGGATGACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017849.1-670s21c1
Sequence:CCGGTGCAGTGTGCCACCGTCATTGCTCGAGCAATGACGGTGGCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks